<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="en">
		<id>http://gtc.wi.mit.edu/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Admin</id>
		<title>Genome Technology Core (GTC) wiki - Sequencing and Microarray - User contributions [en]</title>
		<link rel="self" type="application/atom+xml" href="http://gtc.wi.mit.edu/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Admin"/>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php/Special:Contributions/Admin"/>
		<updated>2026-04-16T10:04:04Z</updated>
		<subtitle>User contributions</subtitle>
		<generator>MediaWiki 1.29.2</generator>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=General_Links_Resources&amp;diff=18595</id>
		<title>General Links Resources</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=General_Links_Resources&amp;diff=18595"/>
				<updated>2019-07-15T18:26:20Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;[http://seqanswers.com/ SEQanswers] An information resource and user-driven community focused on all aspects of next-generation genomics.&lt;br /&gt;
----&lt;br /&gt;
[http://www.nature.com/nmeth/focus/moy2007/index.html Nature Methods Focus: Next Generation Sequencing]&lt;br /&gt;
Nature Methods' Method of the Year 2007 goes to next-generation sequencing. This series of articles showcase how these novel sequencing methods came into their own in 2007 and the incredible impact they promise to have in a variety of research applications. The Methods to Watch feature provide a glimpse and a wish list for future Methods of the Year. &lt;br /&gt;
----&lt;br /&gt;
[http://www.ncbi.nlm.nih.gov/geo NCBI GEO]&lt;br /&gt;
Gene Expression Omnibus is a gene expression/molecular abundance repository supporting MIAME compliant data submissions, and a curated, online resource for gene expression data browsing, query and retrieval.&lt;br /&gt;
----&lt;br /&gt;
[http://www.yeastgenome.org/ Saccharomyces Genome Database (SGD)]&lt;br /&gt;
SGD is a scientific database of the molecular biology and genetics of the yeast Saccharomyces cerevisiae, which is commonly known as baker's or budding yeast.&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=SubmissionGuide&amp;diff=18594</id>
		<title>SubmissionGuide</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=SubmissionGuide&amp;diff=18594"/>
				<updated>2019-07-15T18:25:01Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Please be advised that WIGTC cannot archive customer samples (input materials and libraries) for longer than three months from the time of submission. Please contact us if you would like to arrange to collect your samples during that time.&lt;br /&gt;
&lt;br /&gt;
{{SeqSubmissionGuide}}&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=Main_Page&amp;diff=18593</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=Main_Page&amp;diff=18593"/>
				<updated>2019-07-15T18:20:44Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{| style=&amp;quot;font-style:italic; font-size:120%; width:100%; border:2px solid white; height:100px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
| [[image:Lab-Panorama-shot-web.jpg|center]]&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
{| style=&amp;quot;border:1px solid red; color: white; text-align: center; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
| &amp;lt;h3 align=&amp;quot;center&amp;quot;&amp;gt; [[SingleCell|New - Single Cell Sequencing]]&amp;lt;/h3&amp;gt;&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
{| style=&amp;quot;background:white; color:black; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
{|&lt;br /&gt;
|&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:800px; height:100px; text-align: center&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | [[Services]]&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:100%&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
* [[Sequencing]] - Next-gen sequencing on the Illumina platform including library prep services and quality control.&lt;br /&gt;
* Library Prep&lt;br /&gt;
* [[SingleCell|Single Cell Sequencing]]&lt;br /&gt;
* [[NanoString]]&lt;br /&gt;
* [[RT_PCR|Real-Time PCR]]&lt;br /&gt;
* Bioanalyzer&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
{| style=&amp;quot;background:white; color:black; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:400px; height:140px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Hot Links&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:100%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
* [https://cores.wi.mit.edu/ External Lab Customer Registration]&lt;br /&gt;
* [[Forms|Sample Submission Forms (All Services)]]&lt;br /&gt;
* [[SubmissionGuide|Sample Submission Guide (Seq and Array)]]&lt;br /&gt;
* [[Calendar|Resource Scheduling Systems for RT PCR]]&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
||&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:400px; height:140px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Data Related Resources&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:100%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
* [[SequencingQC|Sequencing QC]]&lt;br /&gt;
* [[SequencingFormats|Sequencing Formats]]&lt;br /&gt;
* Analysis - [[Scripts|Scripts]], [[Data_Analysis_Resources|Other Resources]]&lt;br /&gt;
* [[General_Links_Resources|General Links]]&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
{| style=&amp;quot;background:white; color:black; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:400px; height:120px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Contact Us&lt;br /&gt;
{| style=&amp;quot;text-align: center; width:100%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
455 Main Street, &amp;lt;br&amp;gt; &lt;br /&gt;
Cambridge, MA - 02142 &amp;lt;br&amp;gt;&lt;br /&gt;
Tel: 617-258-8803 &amp;lt;br&amp;gt;&lt;br /&gt;
[[wibr-genome at wi dot mit dot edu]]&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
||&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:400px; height:120px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Other General Information&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:100%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
* [[Personnel]] - [[Tom_Volkert|Tom Volkert]], [[Jennifer_Love|Jennifer Love]], [[Sumeet_Gupta|Sumeet Gupta]], Stephen Mraz III, Amanda Chilaka&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=Main_Page&amp;diff=18592</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=Main_Page&amp;diff=18592"/>
				<updated>2019-07-15T18:20:20Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{| style=&amp;quot;font-style:italic; font-size:120%; width:100%; border:2px solid white; height:100px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
| [[image:Lab-Panorama-shot-web.jpg|center]]&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
{| style=&amp;quot;border:1px solid red; color: white; text-align: center; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
| &amp;lt;h3 align=&amp;quot;center&amp;quot;&amp;gt; [[SingleCell|New - Single Cell Sequencing]]&amp;lt;/h3&amp;gt;&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
{| style=&amp;quot;background:white; color:black; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
{|&lt;br /&gt;
|&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:800px; height:100px; text-align: center&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | [[Services]]&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:100%&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
* [[Sequencing]] - Next-gen sequencing on the Illumina platform including library prep services and quality control.&lt;br /&gt;
* Library Prep&lt;br /&gt;
* [[SingleCell|Single Cell Sequencing]&lt;br /&gt;
* [[NanoString]]&lt;br /&gt;
* [[RT_PCR|Real-Time PCR]]&lt;br /&gt;
* Bioanalyzer&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
{| style=&amp;quot;background:white; color:black; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:400px; height:140px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Hot Links&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:100%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
* [https://cores.wi.mit.edu/ External Lab Customer Registration]&lt;br /&gt;
* [[Forms|Sample Submission Forms (All Services)]]&lt;br /&gt;
* [[SubmissionGuide|Sample Submission Guide (Seq and Array)]]&lt;br /&gt;
* [[Calendar|Resource Scheduling Systems for RT PCR]]&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
||&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:400px; height:140px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Data Related Resources&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:100%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
* [[SequencingQC|Sequencing QC]]&lt;br /&gt;
* [[SequencingFormats|Sequencing Formats]]&lt;br /&gt;
* Analysis - [[Scripts|Scripts]], [[Data_Analysis_Resources|Other Resources]]&lt;br /&gt;
* [[General_Links_Resources|General Links]]&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
{| style=&amp;quot;background:white; color:black; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:400px; height:120px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Contact Us&lt;br /&gt;
{| style=&amp;quot;text-align: center; width:100%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
455 Main Street, &amp;lt;br&amp;gt; &lt;br /&gt;
Cambridge, MA - 02142 &amp;lt;br&amp;gt;&lt;br /&gt;
Tel: 617-258-8803 &amp;lt;br&amp;gt;&lt;br /&gt;
[[wibr-genome at wi dot mit dot edu]]&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
||&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:400px; height:120px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Other General Information&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:100%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
* [[Personnel]] - [[Tom_Volkert|Tom Volkert]], [[Jennifer_Love|Jennifer Love]], [[Sumeet_Gupta|Sumeet Gupta]], Stephen Mraz III, Amanda Chilaka&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=Main_Page&amp;diff=18591</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=Main_Page&amp;diff=18591"/>
				<updated>2019-07-15T18:19:42Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{| style=&amp;quot;font-style:italic; font-size:120%; width:100%; border:2px solid white; height:100px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
| [[image:Lab-Panorama-shot-web.jpg|center]]&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
{| style=&amp;quot;border:1px solid red; color: white; text-align: center; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
| &amp;lt;h3 align=&amp;quot;center&amp;quot;&amp;gt; [[SingleCell|New - Single Cell Sequencing]]&amp;lt;/h3&amp;gt;&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
{| style=&amp;quot;background:white; color:black; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
{|&lt;br /&gt;
|&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:800px; height:100px; text-align: center&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | [[Services]]&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:100%&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
* [[Sequencing]] - Next-gen sequencing on the Illumina platform including library prep services and quality control.&lt;br /&gt;
* Library Prep&lt;br /&gt;
* Single Cell Sequencing&lt;br /&gt;
* [[NanoString]]&lt;br /&gt;
* [[RT_PCR|Real-Time PCR]]&lt;br /&gt;
* Bioanalyzer&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
{| style=&amp;quot;background:white; color:black; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:400px; height:140px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Hot Links&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:100%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
* [https://cores.wi.mit.edu/ External Lab Customer Registration]&lt;br /&gt;
* [[Forms|Sample Submission Forms (All Services)]]&lt;br /&gt;
* [[SubmissionGuide|Sample Submission Guide (Seq and Array)]]&lt;br /&gt;
* [[Calendar|Resource Scheduling Systems for RT PCR]]&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
||&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:400px; height:140px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Data Related Resources&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:100%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
* [[SequencingQC|Sequencing QC]]&lt;br /&gt;
* [[SequencingFormats|Sequencing Formats]]&lt;br /&gt;
* Analysis - [[Scripts|Scripts]], [[Data_Analysis_Resources|Other Resources]]&lt;br /&gt;
* [[General_Links_Resources|General Links]]&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
{| style=&amp;quot;background:white; color:black; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:400px; height:120px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Contact Us&lt;br /&gt;
{| style=&amp;quot;text-align: center; width:100%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
455 Main Street, &amp;lt;br&amp;gt; &lt;br /&gt;
Cambridge, MA - 02142 &amp;lt;br&amp;gt;&lt;br /&gt;
Tel: 617-258-8803 &amp;lt;br&amp;gt;&lt;br /&gt;
[[wibr-genome at wi dot mit dot edu]]&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
||&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:400px; height:120px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Other General Information&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:100%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
* [[Personnel]] - [[Tom_Volkert|Tom Volkert]], [[Jennifer_Love|Jennifer Love]], [[Sumeet_Gupta|Sumeet Gupta]], Stephen Mraz III, Amanda Chilaka&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=Main_Page&amp;diff=18590</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=Main_Page&amp;diff=18590"/>
				<updated>2019-07-15T18:19:16Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{| style=&amp;quot;font-style:italic; font-size:120%; width:100%; border:2px solid white; height:100px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
| [[image:Lab-Panorama-shot-web.jpg|center]]&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
{| style=&amp;quot;border:1px solid red; color: white; text-align: center; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
| &amp;lt;h3 align=&amp;quot;center&amp;quot;&amp;gt; [[SingleCell|New - Single Cell Sequencing]]&amp;lt;/h3&amp;gt;&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
{| style=&amp;quot;background:white; color:black; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
{|&lt;br /&gt;
|&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:800px; height:100px; text-align: center&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | [[Services]]&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:100%&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
* [[Sequencing]] - Next-gen sequencing on the Illumina platform including library prep services and quality control.&lt;br /&gt;
* Library Prep&lt;br /&gt;
* Single Cell Sequencing&lt;br /&gt;
* [[NanoString]]&lt;br /&gt;
* [Real-Time PCR|RT_PCR]&lt;br /&gt;
* Bioanalyzer&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
{| style=&amp;quot;background:white; color:black; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:400px; height:140px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Hot Links&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:100%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
* [https://cores.wi.mit.edu/ External Lab Customer Registration]&lt;br /&gt;
* [[Forms|Sample Submission Forms (All Services)]]&lt;br /&gt;
* [[SubmissionGuide|Sample Submission Guide (Seq and Array)]]&lt;br /&gt;
* [[Calendar|Resource Scheduling Systems for RT PCR]]&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
||&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:400px; height:140px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Data Related Resources&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:100%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
* [[SequencingQC|Sequencing QC]]&lt;br /&gt;
* [[SequencingFormats|Sequencing Formats]]&lt;br /&gt;
* Analysis - [[Scripts|Scripts]], [[Data_Analysis_Resources|Other Resources]]&lt;br /&gt;
* [[General_Links_Resources|General Links]]&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
{| style=&amp;quot;background:white; color:black; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:400px; height:120px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Contact Us&lt;br /&gt;
{| style=&amp;quot;text-align: center; width:100%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
455 Main Street, &amp;lt;br&amp;gt; &lt;br /&gt;
Cambridge, MA - 02142 &amp;lt;br&amp;gt;&lt;br /&gt;
Tel: 617-258-8803 &amp;lt;br&amp;gt;&lt;br /&gt;
[[wibr-genome at wi dot mit dot edu]]&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
||&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:400px; height:120px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Other General Information&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:100%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
* [[Personnel]] - [[Tom_Volkert|Tom Volkert]], [[Jennifer_Love|Jennifer Love]], [[Sumeet_Gupta|Sumeet Gupta]], Stephen Mraz III, Amanda Chilaka&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=Main_Page&amp;diff=18589</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=Main_Page&amp;diff=18589"/>
				<updated>2019-07-15T18:18:48Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{| style=&amp;quot;font-style:italic; font-size:120%; width:100%; border:2px solid white; height:100px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
| [[image:Lab-Panorama-shot-web.jpg|center]]&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
{| style=&amp;quot;border:1px solid red; color: white; text-align: center; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
| &amp;lt;h3 align=&amp;quot;center&amp;quot;&amp;gt; [[SingleCell|New - Single Cell Sequencing]]&amp;lt;/h3&amp;gt;&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
{| style=&amp;quot;background:white; color:black; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
{|&lt;br /&gt;
|&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:800px; height:100px; text-align: center&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | [[Services]]&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:100%&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
* [[Sequencing]] - Next-gen sequencing on the Illumina platform including library prep services and quality control.&lt;br /&gt;
* Library Prep&lt;br /&gt;
* Single Cell Sequencing&lt;br /&gt;
* [[NanoString]]&lt;br /&gt;
* Real-Time PCR&lt;br /&gt;
* Bioanalyzer&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
{| style=&amp;quot;background:white; color:black; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:400px; height:140px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Hot Links&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:100%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
* [https://cores.wi.mit.edu/ External Lab Customer Registration]&lt;br /&gt;
* [[Forms|Sample Submission Forms (All Services)]]&lt;br /&gt;
* [[SubmissionGuide|Sample Submission Guide (Seq and Array)]]&lt;br /&gt;
* [[Calendar|Resource Scheduling Systems for RT PCR]]&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
||&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:400px; height:140px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Data Related Resources&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:100%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
* [[SequencingQC|Sequencing QC]]&lt;br /&gt;
* [[SequencingFormats|Sequencing Formats]]&lt;br /&gt;
* Analysis - [[Scripts|Scripts]], [[Data_Analysis_Resources|Other Resources]]&lt;br /&gt;
* [[General_Links_Resources|General Links]]&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
{| style=&amp;quot;background:white; color:black; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:400px; height:120px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Contact Us&lt;br /&gt;
{| style=&amp;quot;text-align: center; width:100%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
455 Main Street, &amp;lt;br&amp;gt; &lt;br /&gt;
Cambridge, MA - 02142 &amp;lt;br&amp;gt;&lt;br /&gt;
Tel: 617-258-8803 &amp;lt;br&amp;gt;&lt;br /&gt;
[[wibr-genome at wi dot mit dot edu]]&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
||&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:400px; height:120px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Other General Information&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:100%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
* [[Personnel]] - [[Tom_Volkert|Tom Volkert]], [[Jennifer_Love|Jennifer Love]], [[Sumeet_Gupta|Sumeet Gupta]], Stephen Mraz III, Amanda Chilaka&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=Main_Page&amp;diff=18588</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=Main_Page&amp;diff=18588"/>
				<updated>2019-07-15T18:17:54Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{| style=&amp;quot;font-style:italic; font-size:120%; width:100%; border:2px solid white; height:100px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
| [[image:Lab-Panorama-shot-web.jpg|center]]&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
{| style=&amp;quot;border:1px solid red; color: white; text-align: center; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
| &amp;lt;h3 align=&amp;quot;center&amp;quot;&amp;gt; [[SingleCell|New - Single Cell Sequencing]]&amp;lt;/h3&amp;gt;&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
{| style=&amp;quot;background:white; color:black; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
{|&lt;br /&gt;
|&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:800px; height:100px; text-align: center&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | [[Services]]&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:100%&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
* [[Sequencing]] - Next-gen sequencing on the Illumina platform including library prep services and quality control.&lt;br /&gt;
* Library Prep&lt;br /&gt;
* Single Cell Sequencing&lt;br /&gt;
* [[Nanostring]]&lt;br /&gt;
* Real-Time PCR&lt;br /&gt;
* Bioanalyzer&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
{| style=&amp;quot;background:white; color:black; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:400px; height:140px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Hot Links&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:100%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
* [https://cores.wi.mit.edu/ External Lab Customer Registration]&lt;br /&gt;
* [[Forms|Sample Submission Forms (All Services)]]&lt;br /&gt;
* [[SubmissionGuide|Sample Submission Guide (Seq and Array)]]&lt;br /&gt;
* [[Calendar|Resource Scheduling Systems for RT PCR]]&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
||&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:400px; height:140px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Data Related Resources&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:100%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
* [[SequencingQC|Sequencing QC]]&lt;br /&gt;
* [[SequencingFormats|Sequencing Formats]]&lt;br /&gt;
* Analysis - [[Scripts|Scripts]], [[Data_Analysis_Resources|Other Resources]]&lt;br /&gt;
* [[General_Links_Resources|General Links]]&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
{| style=&amp;quot;background:white; color:black; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:400px; height:120px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Contact Us&lt;br /&gt;
{| style=&amp;quot;text-align: center; width:100%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
455 Main Street, &amp;lt;br&amp;gt; &lt;br /&gt;
Cambridge, MA - 02142 &amp;lt;br&amp;gt;&lt;br /&gt;
Tel: 617-258-8803 &amp;lt;br&amp;gt;&lt;br /&gt;
[[wibr-genome at wi dot mit dot edu]]&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
||&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:400px; height:120px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Other General Information&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:100%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
* [[Personnel]] - [[Tom_Volkert|Tom Volkert]], [[Jennifer_Love|Jennifer Love]], [[Sumeet_Gupta|Sumeet Gupta]], Stephen Mraz III, Amanda Chilaka&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=18587</id>
		<title>MediaWiki:Sidebar</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=18587"/>
				<updated>2019-07-15T18:17:43Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;* navigation&lt;br /&gt;
** mainpage|Genome Core Home&lt;br /&gt;
** Pricing|Pricing&lt;br /&gt;
** Personnel|Personnel&lt;br /&gt;
** Forms|Sample Submission&lt;br /&gt;
&lt;br /&gt;
* Services&lt;br /&gt;
** Sequencing|Sequencing&lt;br /&gt;
&lt;br /&gt;
* Equipment Resources&lt;br /&gt;
** Calendar|Resource Scheduling&lt;br /&gt;
** RT_PCR|RT PCR&lt;br /&gt;
&lt;br /&gt;
* External Lab Registration&lt;br /&gt;
** http://cores.wi.mit.edu|WISCe&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=18586</id>
		<title>MediaWiki:Sidebar</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=18586"/>
				<updated>2019-07-15T18:17:06Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;* navigation&lt;br /&gt;
** mainpage|Genome Core Home&lt;br /&gt;
** Pricing|Pricing&lt;br /&gt;
** Personnel|Personnel&lt;br /&gt;
** Forms|Sample Submission&lt;br /&gt;
&lt;br /&gt;
* Services&lt;br /&gt;
** Sequencing|Sequencing&lt;br /&gt;
&lt;br /&gt;
* Equipment Resources&lt;br /&gt;
** Calendar|Resource Scheduling&lt;br /&gt;
** RT_PCR|RT PCR&lt;br /&gt;
** NanoString|NanoString&lt;br /&gt;
&lt;br /&gt;
* External Lab Registration&lt;br /&gt;
** http://cores.wi.mit.edu|WISCe&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=18565</id>
		<title>MediaWiki:Sidebar</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=18565"/>
				<updated>2018-07-11T15:53:20Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;* navigation&lt;br /&gt;
** mainpage|Genome Core Home&lt;br /&gt;
** Pricing|Pricing&lt;br /&gt;
** Personnel|Personnel&lt;br /&gt;
** Forms|Sample Submission&lt;br /&gt;
&lt;br /&gt;
* Services&lt;br /&gt;
** Sequencing|Sequencing&lt;br /&gt;
** Microarray_Analysis|Microarray&lt;br /&gt;
&lt;br /&gt;
* Equipment Resources&lt;br /&gt;
** Calendar|Resource Scheduling&lt;br /&gt;
** RT_PCR|RT PCR&lt;br /&gt;
** NanoString|NanoString&lt;br /&gt;
&lt;br /&gt;
* External Lab Registration&lt;br /&gt;
** http://cores.wi.mit.edu|WISCe&lt;br /&gt;
&lt;br /&gt;
* Data Related Resources&lt;br /&gt;
** Data_Analysis_Resources|Data Analysis&lt;br /&gt;
** Microarray_data_submit_Guide_GEO|NCBI Data Submission Guide&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=18564</id>
		<title>MediaWiki:Sidebar</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=18564"/>
				<updated>2018-07-11T15:53:10Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;* navigation&lt;br /&gt;
** mainpage|Genome Core Home&lt;br /&gt;
** Pricing|Pricing&lt;br /&gt;
** Personnel|Personnel&lt;br /&gt;
** Forms|Sample Submission&lt;br /&gt;
&lt;br /&gt;
* Services&lt;br /&gt;
** Sequencing|Sequencing&lt;br /&gt;
** Microarray_Analysis|Microarray&lt;br /&gt;
&lt;br /&gt;
* Equipment Resources&lt;br /&gt;
** Calendar|Resource Scheduling&lt;br /&gt;
** RT_PCR|RT PCR&lt;br /&gt;
** NanoString|NanoString&lt;br /&gt;
&lt;br /&gt;
* External Lab Registration&lt;br /&gt;
** http://cores.wi.mit.edu|WISCe Registration&lt;br /&gt;
&lt;br /&gt;
* Data Related Resources&lt;br /&gt;
** Data_Analysis_Resources|Data Analysis&lt;br /&gt;
** Microarray_data_submit_Guide_GEO|NCBI Data Submission Guide&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=18563</id>
		<title>MediaWiki:Sidebar</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=18563"/>
				<updated>2018-07-11T15:52:39Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;* navigation&lt;br /&gt;
** mainpage|Genome Core Home&lt;br /&gt;
** Pricing|Pricing&lt;br /&gt;
** Personnel|Personnel&lt;br /&gt;
** Forms|Sample Submission&lt;br /&gt;
&lt;br /&gt;
* Services&lt;br /&gt;
** Sequencing|Sequencing&lt;br /&gt;
** Microarray_Analysis|Microarray&lt;br /&gt;
&lt;br /&gt;
* Equipment Resources&lt;br /&gt;
** Calendar|Resource Scheduling&lt;br /&gt;
** RT_PCR|RT PCR&lt;br /&gt;
** NanoString|NanoString&lt;br /&gt;
&lt;br /&gt;
* External Customer&lt;br /&gt;
** http://cores.wi.mit.edu|WISCe Registration&lt;br /&gt;
&lt;br /&gt;
* Data Related Resources&lt;br /&gt;
** Data_Analysis_Resources|Data Analysis&lt;br /&gt;
** Microarray_data_submit_Guide_GEO|NCBI Data Submission Guide&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=18562</id>
		<title>MediaWiki:Sidebar</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=18562"/>
				<updated>2018-07-11T15:52:04Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;* navigation&lt;br /&gt;
** mainpage|Genome Core Home&lt;br /&gt;
** Pricing|Pricing&lt;br /&gt;
** Personnel|Personnel&lt;br /&gt;
** Forms|Sample Submission&lt;br /&gt;
&lt;br /&gt;
* Services&lt;br /&gt;
** Sequencing|Sequencing&lt;br /&gt;
** Microarray_Analysis|Microarray&lt;br /&gt;
&lt;br /&gt;
* Equipment Resources&lt;br /&gt;
** Calendar|Resource Scheduling&lt;br /&gt;
** RT_PCR|RT PCR&lt;br /&gt;
** NanoString|NanoString&lt;br /&gt;
&lt;br /&gt;
* External Customer Registration&lt;br /&gt;
** http://cores.wi.mit.edu|WISCe&lt;br /&gt;
&lt;br /&gt;
* Data Related Resources&lt;br /&gt;
** Data_Analysis_Resources|Data Analysis&lt;br /&gt;
** Microarray_data_submit_Guide_GEO|NCBI Data Submission Guide&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=18408</id>
		<title>MediaWiki:Sidebar</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=18408"/>
				<updated>2015-01-13T00:02:23Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;* navigation&lt;br /&gt;
** mainpage|Genome Core Home&lt;br /&gt;
** Pricing|Pricing&lt;br /&gt;
** Personnel|Personnel&lt;br /&gt;
** Forms|Sample Submission&lt;br /&gt;
&lt;br /&gt;
* Services&lt;br /&gt;
** Sequencing|Sequencing&lt;br /&gt;
** Microarray_Analysis|Microarray&lt;br /&gt;
&lt;br /&gt;
* Equipment Resources&lt;br /&gt;
** Calendar|Resource Scheduling&lt;br /&gt;
** RT_PCR|RT PCR&lt;br /&gt;
** NanoString|NanoString&lt;br /&gt;
&lt;br /&gt;
* Data Related Resources&lt;br /&gt;
** Data_Analysis_Resources|Data Analysis&lt;br /&gt;
** Microarray_data_submit_Guide_GEO|NCBI Data Submission Guide&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=18315</id>
		<title>MediaWiki:Sidebar</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=18315"/>
				<updated>2013-10-16T18:43:21Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;* navigation&lt;br /&gt;
** mainpage|Genome Core Home&lt;br /&gt;
** Services|Services&lt;br /&gt;
** Pricing|Pricing&lt;br /&gt;
** Personnel|Personnel&lt;br /&gt;
** Calendar|Resource Scheduling&lt;br /&gt;
** Forms|Sample Submission&lt;br /&gt;
&lt;br /&gt;
* Equipment Resources&lt;br /&gt;
** RT_PCR|RT PCR&lt;br /&gt;
** NanoString|NanoString&lt;br /&gt;
&lt;br /&gt;
* Data Related Resources&lt;br /&gt;
** Data_Analysis_Resources|Data Analysis&lt;br /&gt;
** Microarray_data_submit_Guide_GEO|NCBI Data Submission Guide&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=File:New_Cust_Bill_Frmv3.xls&amp;diff=18288</id>
		<title>File:New Cust Bill Frmv3.xls</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=File:New_Cust_Bill_Frmv3.xls&amp;diff=18288"/>
				<updated>2013-04-18T14:12:44Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: New Customer Form&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;New Customer Form&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=Forms&amp;diff=18287</id>
		<title>Forms</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=Forms&amp;diff=18287"/>
				<updated>2013-04-18T14:12:23Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{TopRightSideBar|&lt;br /&gt;
|title=Sample Submission Forms&lt;br /&gt;
|image=Forms.jpg&lt;br /&gt;
|subtitle=Sample Submission Forms&lt;br /&gt;
|highlights=    &lt;br /&gt;
&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
=New Customer Form=&lt;br /&gt;
[[Media:New_Cust_Bill_Frmv3.xls|New Customer Form]]&lt;br /&gt;
&lt;br /&gt;
=Sequencing=&lt;br /&gt;
[http://jura.wi.mit.edu/gtc/sequencing/samplesubmission/samplesubmission.php Illumina Sequencing Submission Form]&lt;br /&gt;
&lt;br /&gt;
[[Sequencing| Service Details...]]&lt;br /&gt;
&lt;br /&gt;
=Microarray=&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[Media:AffySubForm v12.xls|Affy Expression Analysis Form]]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[[Media:MicroarraySubForm v14.xls|Agilent Expression Analysis Form]]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[[Media:GWLASubForm_v5.xls|Agilent ChIP-CHIP Form]]&lt;br /&gt;
&lt;br /&gt;
[[Microarray_Analysis| Service Details...]]&lt;br /&gt;
&lt;br /&gt;
= Bioanalyzer/Sample QC =&lt;br /&gt;
[[Media:QCSubForm_ForWeb_V3.xls|Bioanalyzer QC Sample Submission Form]]&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=Forms&amp;diff=18284</id>
		<title>Forms</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=Forms&amp;diff=18284"/>
				<updated>2013-01-10T17:19:33Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{TopRightSideBar|&lt;br /&gt;
|title=Sample Submission Forms&lt;br /&gt;
|image=Forms.jpg&lt;br /&gt;
|subtitle=Sample Submission Forms&lt;br /&gt;
|highlights=    &lt;br /&gt;
&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
=New Customer Form=&lt;br /&gt;
[[Media:New_Cust_Bill_Frmv2.xls|New Customer Form]]&lt;br /&gt;
&lt;br /&gt;
=Sequencing=&lt;br /&gt;
[http://jura.wi.mit.edu/gtc/sequencing/samplesubmission/samplesubmission.php Illumina Sequencing Submission Form]&lt;br /&gt;
&lt;br /&gt;
[[Sequencing| Service Details...]]&lt;br /&gt;
&lt;br /&gt;
=Microarray=&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[Media:AffySubForm v12.xls|Affy Expression Analysis Form]]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[[Media:MicroarraySubForm v14.xls|Agilent Expression Analysis Form]]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[[Media:GWLASubForm_v5.xls|Agilent ChIP-CHIP Form]]&lt;br /&gt;
&lt;br /&gt;
[[Microarray_Analysis| Service Details...]]&lt;br /&gt;
&lt;br /&gt;
= Bioanalyzer/Sample QC =&lt;br /&gt;
[[Media:QCSubForm_ForWeb_V3.xls|Bioanalyzer QC Sample Submission Form]]&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=Forms&amp;diff=18283</id>
		<title>Forms</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=Forms&amp;diff=18283"/>
				<updated>2013-01-10T17:17:52Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{TopRightSideBar|&lt;br /&gt;
|title=Sample Submission Forms&lt;br /&gt;
|image=Forms.jpg&lt;br /&gt;
|subtitle=Sample Submission Forms&lt;br /&gt;
|highlights=    &lt;br /&gt;
&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
=New Customer Form=&lt;br /&gt;
[[Media:New_Cust_Bill_Frmv2.xls|New Customer Form]]&lt;br /&gt;
&lt;br /&gt;
=Sequencing=&lt;br /&gt;
[http://jura.wi.mit.edu/gtc/sequencing/samplesubmission/samplesubmission.php Illumina Sequencing Submission Form]&lt;br /&gt;
&lt;br /&gt;
[[Sequencing| Service Details...]]&lt;br /&gt;
&lt;br /&gt;
=Microarray=&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[Media:AffySubForm v12.xls|Affy Expression Analysis Form]]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[[Media:MicroarraySubForm v14.xls|Agilent Expression Analysis Form]]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[[Media:GWLASubForm_v5.xls|Agilent ChIP-CHIP Form]]&lt;br /&gt;
&lt;br /&gt;
[[Microarray_Analysis| Service Details...]]&lt;br /&gt;
&lt;br /&gt;
=Other Services=&lt;br /&gt;
&lt;br /&gt;
== Bioanalyzer/Sample QC ==&lt;br /&gt;
[[Media:QCSubForm_ForWeb_V3.xls|Bioanalyzer QC Sample Submission Form]]&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=Forms&amp;diff=18282</id>
		<title>Forms</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=Forms&amp;diff=18282"/>
				<updated>2013-01-10T17:06:52Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{TopRightSideBar|&lt;br /&gt;
|title=Sample Submission Forms&lt;br /&gt;
|image=Forms.jpg&lt;br /&gt;
|subtitle=Sample Submission Forms&lt;br /&gt;
|highlights=    &lt;br /&gt;
&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
=New Customer Form=&lt;br /&gt;
[[Media:New_Cust_Bill_Frmv2.xls|New Customer Form]]&lt;br /&gt;
&lt;br /&gt;
=Sequencing=&lt;br /&gt;
[http://jura.wi.mit.edu/gtc/sequencing/samplesubmission/samplesubmission.php Illumina Sequencing Submission Form]&lt;br /&gt;
&lt;br /&gt;
[[Sequencing| Service Details...]]&lt;br /&gt;
&lt;br /&gt;
=Microarray=&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[Media:AffySubForm v12.xls|Affy Expression Analysis Sample Submission Form]]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[[Media:MicroarraySubForm v14.xls|Agilent Expression Analysis Sample Submission Form]]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[[Media:GWLASubForm_v5.xls|Agilent ChIP-CHIP Sample Submission Form]]&lt;br /&gt;
&lt;br /&gt;
[[Microarray_Analysis| Service Details...]]&lt;br /&gt;
&lt;br /&gt;
=Other Services=&lt;br /&gt;
&lt;br /&gt;
== Bioanalyzer/Sample QC ==&lt;br /&gt;
[[Media:QCSubForm_ForWeb_V3.xls|Bioanalyzer QC Sample Submission Form]]&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=Forms&amp;diff=18281</id>
		<title>Forms</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=Forms&amp;diff=18281"/>
				<updated>2013-01-10T17:06:24Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{TopRightSideBar|&lt;br /&gt;
|title=Sample Submission Forms&lt;br /&gt;
|image=Forms.jpg&lt;br /&gt;
|subtitle=Sample Submission Forms&lt;br /&gt;
|highlights=    &lt;br /&gt;
&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
=New Customer Form=&lt;br /&gt;
[[Media:New_Cust_Bill_Frmv2.xls|New Customer Form]]&lt;br /&gt;
&lt;br /&gt;
=Sequencing=&lt;br /&gt;
[http://jura.wi.mit.edu/gtc/sequencing/samplesubmission/samplesubmission.php Illumina Sequencing Submission Form]&lt;br /&gt;
&lt;br /&gt;
[[Sequencing| Service Details...]]&lt;br /&gt;
&lt;br /&gt;
=Microarray=&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[Media:AffySubForm v12.xls|Affy Expression Analysis Sample Submission Form]]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[[Media:MicroarraySubForm v14.xls|Agilent Expression Analysis Sample Submission Form]]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[[Media:GWLASubForm_v5.xls|Agilent ChIP-CHIP Sample Submission Form]]&lt;br /&gt;
&lt;br /&gt;
[[ChIP_on_Chip| Service Details...]]&lt;br /&gt;
&lt;br /&gt;
=Other Services=&lt;br /&gt;
&lt;br /&gt;
== Bioanalyzer/Sample QC ==&lt;br /&gt;
[[Media:QCSubForm_ForWeb_V3.xls|Bioanalyzer QC Sample Submission Form]]&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=Forms&amp;diff=18280</id>
		<title>Forms</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=Forms&amp;diff=18280"/>
				<updated>2013-01-10T17:05:33Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{TopRightSideBar|&lt;br /&gt;
|title=Sample Submission Forms&lt;br /&gt;
|image=Forms.jpg&lt;br /&gt;
|subtitle=Sample Submission Forms&lt;br /&gt;
|highlights=    &lt;br /&gt;
&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
=New Customer Form=&lt;br /&gt;
[[Media:New_Cust_Bill_Frmv2.xls|New Customer Form]]&lt;br /&gt;
&lt;br /&gt;
=Sequencing=&lt;br /&gt;
[http://jura.wi.mit.edu/gtc/sequencing/samplesubmission/samplesubmission.php Illumina Sequencing Submission Form]&lt;br /&gt;
&lt;br /&gt;
[[Sequencing| Service Details...]]&lt;br /&gt;
&lt;br /&gt;
=Microarray=&lt;br /&gt;
&lt;br /&gt;
[[ChIP_on_Chip| Service Details...]]&lt;br /&gt;
&lt;br /&gt;
== Expression Analysis ==&lt;br /&gt;
[[Media:AffySubForm v12.xls|Affy Sample Submission Form]]&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[[Media:MicroarraySubForm v14.xls|Agilent Sample Submission Form]]&lt;br /&gt;
&lt;br /&gt;
== ChIP on Chip/Location Analysis ==&lt;br /&gt;
[[Media:GWLASubForm_v5.xls|Agilent ChIP-CHIP Sample Submission Form]]&lt;br /&gt;
&lt;br /&gt;
=Other Services=&lt;br /&gt;
&lt;br /&gt;
== Bioanalyzer/Sample QC ==&lt;br /&gt;
[[Media:QCSubForm_ForWeb_V3.xls|Bioanalyzer QC Sample Submission Form]]&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=18279</id>
		<title>MediaWiki:Sidebar</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=18279"/>
				<updated>2013-01-10T17:03:02Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;* navigation&lt;br /&gt;
** mainpage|Genome Core Home&lt;br /&gt;
** Services|Services&lt;br /&gt;
** Pricing|Pricing&lt;br /&gt;
** Personnel|Personnel&lt;br /&gt;
** Calendar|Resource Scheduling&lt;br /&gt;
** Forms|Sample Submission&lt;br /&gt;
&lt;br /&gt;
* Equipment Resources&lt;br /&gt;
** RT_PCR|RT PCR&lt;br /&gt;
** HCSCellomics|High Throughput Screening&lt;br /&gt;
** NanoString|NanoString&lt;br /&gt;
&lt;br /&gt;
* Data Related Resources&lt;br /&gt;
** Data_Analysis_Resources|Data Analysis&lt;br /&gt;
** Microarray_data_submit_Guide_GEO|NCBI Data Submission Guide&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=Main_Page&amp;diff=18265</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=Main_Page&amp;diff=18265"/>
				<updated>2013-01-04T18:42:53Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{| style=&amp;quot;font-style:italic; font-size:120%; width:100%; border:2px solid white; height:100px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
| [[image:banner.jpg|center]]&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
{| style=&amp;quot;border:1px solid red; color: white; text-align: center; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
| &amp;lt;h3 align=&amp;quot;center&amp;quot;&amp;gt; [[Retreatposter|Summary of Services and Resources - 2011 WIGTC Retreat Poster]]&amp;lt;/h3&amp;gt;&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
{| style=&amp;quot;border:1px solid green; background: #0000FF; color: white; text-align: center; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
| [[Forms|&amp;lt;span style=&amp;quot;color:white;&amp;quot;&amp;gt;'''Sample Submission Forms For All Services'''&amp;lt;/span&amp;gt;]]&lt;br /&gt;
|}&lt;br /&gt;
{| style=&amp;quot;border:1px solid green; background: #996600; color: white; text-align: center; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
| [[Calendar|&amp;lt;span style=&amp;quot;color:white;&amp;quot;&amp;gt;'''Resource Scheduling Systems for Agilent Microarray Scanner, Cellomics and RT PCR'''&amp;lt;/span&amp;gt;]]&lt;br /&gt;
|}&lt;br /&gt;
{| style=&amp;quot;background:white; color:black; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
{|&lt;br /&gt;
|&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:800px; height:100px; text-align: center&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | [[Services]]&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:100%&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
* [[Sequencing]] - Includes library preparation using SPRIworks, sample QC using BioAnalyzer as well as QPCR, and Sequencing.&lt;br /&gt;
* [[Microarray_Analysis|Microarrays]] - Includes sample QC, labeling and hybridization.&lt;br /&gt;
* Others - BioAnalyzer Sample QC&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
{| style=&amp;quot;background:white; color:black; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:400px; height:140px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Equipment Resources&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:100%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
* [[RT_PCR|RT PCR]]&lt;br /&gt;
* [[HCSCellomics|High Throughput Screening]]&lt;br /&gt;
* [[NanoString|NanoString]]&lt;br /&gt;
* Agilent Microarray Scanner&lt;br /&gt;
* [[Lab_Usage_Plan|Lab Usage Plan]]&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
||&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:400px; height:140px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Data Related Resources&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:100%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
* QC - [[SequencingQC|Sequencing]], [[MicroarrayQC|Microarray]]&lt;br /&gt;
* Formats - [[SequencingFormats|Sequencing]], [[MicroarrayFormats|Microarray]]&lt;br /&gt;
* Analysis - [[Scripts|Scripts]], [[Data_Analysis_Resources|Other Resources]]&lt;br /&gt;
* [[Microarray_data_submit_Guide_GEO|NCBI Data Submission Guide]]&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
{| style=&amp;quot;background:white; color:black; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:400px; height:120px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Contact Us&lt;br /&gt;
{| style=&amp;quot;text-align: center; width:100%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
9 Cambridge Center, &amp;lt;br&amp;gt; &lt;br /&gt;
Cambridge, MA - 02142 &amp;lt;br&amp;gt;&lt;br /&gt;
Tel: 617-258-8803 &amp;lt;br&amp;gt;&lt;br /&gt;
[[wibr-genome at wi dot mit dot edu]]&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
||&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:400px; height:120px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Other General Information&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:100%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
* [[Personnel]] - [[Tom_Volkert|Tom Volkert]], [[Jennifer_Love|Jennifer Love]], [[Sumeet_Gupta|Sumeet Gupta]], [[Jeong-Ah_Kwon|Jeong-Ah Kwon]], La'kesha Francis&lt;br /&gt;
* [[General_Links_Resources|General Links]]&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=Sequencing&amp;diff=18262</id>
		<title>Sequencing</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=Sequencing&amp;diff=18262"/>
				<updated>2012-04-23T18:19:37Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{TopRightSideBar|&lt;br /&gt;
|title=Sequencing Service&lt;br /&gt;
|image=Dna_seq.jpg&lt;br /&gt;
|subtitle=&lt;br /&gt;
|highlights=    &lt;br /&gt;
&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
= Technology =&lt;br /&gt;
&lt;br /&gt;
The GTC offers Next-Generation sequencing on the Illumina platform. We have two GAII systems and one HiSeq2000. The GAII systems typically yield 10-30 million reads per lane in single read or paired end mode. The HiSeq2000 typically yields 70-100 million reads per lane for only about 50% higher costs. Further costs savings can be realized with sample multiplexing. &lt;br /&gt;
&lt;br /&gt;
= Library Prep Services =&lt;br /&gt;
&lt;br /&gt;
We offer three full service options for library prep each using the Illumina TruSeq system with up to 12 unique barcodes for multiplexing. The Manual library prep protocol yields the highest quality libraries and is compatible with low sample inputs for applications like ChIP-seq. The SPRIworks protocol uses the SPRIworks system from Beckman for high-throughput processing and is appropriate for preparing libraries from high quality and quantity DNA inputs. The RNA-seq protocol is a manual protocol starting from total RNA and uses the Illumina TruSeq RNA kit.&lt;br /&gt;
&lt;br /&gt;
= Pricing =&lt;br /&gt;
&lt;br /&gt;
For pricing information - [[Pricing| Click Here]]&lt;br /&gt;
&lt;br /&gt;
= Sample Submission Guidelines =&lt;br /&gt;
&lt;br /&gt;
Please use our sample submission forms found [[Forms|here]].&lt;br /&gt;
&lt;br /&gt;
Users may submit fully prepared libraries with Illumina adapters or dsDNA or total RNA for our library prep services. &lt;br /&gt;
&lt;br /&gt;
User prepared libraries should be gel-purified and provided UNDILUTED in EB or similar. Please submit 10uL of undiluted sample. We will determine the concentration by RT-PCR and make the appropriate dilutions. Excess sample will be retained in our freezers for potential future re-run. Users are also strongly encouraged to retain a portion of their samples in case of emergency. &lt;br /&gt;
&lt;br /&gt;
For the library prep service please submit dsDNA for the standard protocols or total RNA for the RNA-seq protocol. We will provide all reagents for adapter ligation and enrichment. There is a wide range of suitable volumes and concentrations but we will need to know approximate values. &lt;br /&gt;
&lt;br /&gt;
GTC will provide sequencing primers for libraries prepared with standard Illumina adapters. If custom sequencing primers are required they must be provided at the time of sample submission.&lt;br /&gt;
&lt;br /&gt;
= Data =&lt;br /&gt;
&lt;br /&gt;
Images acquired from the sequencer are processed through the bundled Illumina image extraction pipeline to get the sequence and quality score for each base. If requested, the reads can be aligned to a reference genome using the Illumina ELAND algorithm. An in-depth QC report is included in the package.&lt;br /&gt;
&lt;br /&gt;
* QC Details - [[SequencingQC|Sequencing]]&lt;br /&gt;
* Formats Details - [[SequencingFormats|Sequencing]]&lt;br /&gt;
&lt;br /&gt;
== Turnaround Time ==&lt;br /&gt;
&lt;br /&gt;
Each sequencer processes 8 samples per run, or 7 samples plus a control. Full flowcell submissions (7 samples) can usually be started within one week of submission. Partial submissions of less than seven samples are put into a project queue where they join existing samples or await others before processing. Wait times for partial submissions vary but are generally two weeks or less until the START of the run depending on the requested run configuration and demand from other users. The most common run configuration is short (40 bases) and single read. Longer read and paired-end samples may take longer to turn around as there are generally fewer similar samples in the queue to fill out runs. Once a run has started, estimate approximately 1 day per 20 bases for the run and an additional 24-48 hours for data processing. Samples requiring library prep will also take an additional approximately one week for the prep.&lt;br /&gt;
&lt;br /&gt;
= Applications =&lt;br /&gt;
&lt;br /&gt;
Next-Generation Sequencing can be used for a wide variety of applications including ChIP-Seq, RNA-Seq, smallRNA-seq, GWAS and much more. Visit Illumina's web site or contact us to discuss your project goals.&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=Sequencing&amp;diff=18261</id>
		<title>Sequencing</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=Sequencing&amp;diff=18261"/>
				<updated>2012-04-23T18:18:47Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{TopRightSideBar|&lt;br /&gt;
|title=Sequencing Service&lt;br /&gt;
|image=Dna_seq.jpg&lt;br /&gt;
|subtitle=&lt;br /&gt;
|highlights=    &lt;br /&gt;
&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
= Technology =&lt;br /&gt;
&lt;br /&gt;
The GTC offers Next-Generation sequencing on the Illumina platform. We have two GAII systems and one HiSeq2000. The GAII systems typically yield 10-30 million reads per lane in single read or paired end mode. The HiSeq2000 typically yields 70-100 million reads per lane for only about 50% higher costs. Further costs savings can be realized with sample multiplexing. &lt;br /&gt;
&lt;br /&gt;
= Library Prep Services =&lt;br /&gt;
&lt;br /&gt;
We offer three full service options for library prep each using the Illumina TruSeq system with up to 12 unique barcodes for multiplexing. The Manual library prep protocol yields the highest quality libraries and is compatible with low sample inputs for applications like ChIP-seq. The SPRIworks protocol uses the SPRIworks system from Beckman for high-throughput processing and is appropriate for preparing libraries from high quality and quantity DNA inputs. The RNA-seq protocol is a manual protocol starting from total RNA and uses the Illumina TruSeq RNA kit.&lt;br /&gt;
&lt;br /&gt;
= Pricing =&lt;br /&gt;
&lt;br /&gt;
For pricing information - [[Pricing| Click Here]]&lt;br /&gt;
&lt;br /&gt;
= Sample Submission Guidelines =&lt;br /&gt;
&lt;br /&gt;
Please use our sample submission forms found [[Forms|here]]. Internal users should use the online form, external users should download the excel form. &lt;br /&gt;
&lt;br /&gt;
Users may submit fully prepared libraries with Illumina adapters or dsDNA or total RNA for our library prep services. &lt;br /&gt;
&lt;br /&gt;
User prepared libraries should be gel-purified and provided UNDILUTED in EB or similar. Please submit 10uL of undiluted sample. We will determine the concentration by RT-PCR and make the appropriate dilutions. Excess sample will be retained in our freezers for potential future re-run. Users are also strongly encouraged to retain a portion of their samples in case of emergency. &lt;br /&gt;
&lt;br /&gt;
For the library prep service please submit dsDNA for the standard protocols or total RNA for the RNA-seq protocol. We will provide all reagents for adapter ligation and enrichment. There is a wide range of suitable volumes and concentrations but we will need to know approximate values. &lt;br /&gt;
&lt;br /&gt;
GTC will provide sequencing primers for libraries prepared with standard Illumina adapters. If custom sequencing primers are required they must be provided at the time of sample submission.&lt;br /&gt;
&lt;br /&gt;
= Data =&lt;br /&gt;
&lt;br /&gt;
Images acquired from the sequencer are processed through the bundled Illumina image extraction pipeline to get the sequence and quality score for each base. If requested, the reads can be aligned to a reference genome using the Illumina ELAND algorithm. An in-depth QC report is included in the package.&lt;br /&gt;
&lt;br /&gt;
* QC Details - [[SequencingQC|Sequencing]]&lt;br /&gt;
* Formats Details - [[SequencingFormats|Sequencing]]&lt;br /&gt;
&lt;br /&gt;
== Turnaround Time ==&lt;br /&gt;
&lt;br /&gt;
Each sequencer processes 8 samples per run, or 7 samples plus a control. Full flowcell submissions (7 samples) can usually be started within one week of submission. Partial submissions of less than seven samples are put into a project queue where they join existing samples or await others before processing. Wait times for partial submissions vary but are generally two weeks or less until the START of the run depending on the requested run configuration and demand from other users. The most common run configuration is short (40 bases) and single read. Longer read and paired-end samples may take longer to turn around as there are generally fewer similar samples in the queue to fill out runs. Once a run has started, estimate approximately 1 day per 20 bases for the run and an additional 24-48 hours for data processing. Samples requiring library prep will also take an additional approximately one week for the prep.&lt;br /&gt;
&lt;br /&gt;
= Applications =&lt;br /&gt;
&lt;br /&gt;
Next-Generation Sequencing can be used for a wide variety of applications including ChIP-Seq, RNA-Seq, smallRNA-seq, GWAS and much more. Visit Illumina's web site or contact us to discuss your project goals.&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=18195</id>
		<title>MediaWiki:Sidebar</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=18195"/>
				<updated>2011-01-19T22:38:08Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;* navigation&lt;br /&gt;
** mainpage|Genome Core Home&lt;br /&gt;
** Services|Services&lt;br /&gt;
** Pricing|Pricing&lt;br /&gt;
** Personnel|Personnel&lt;br /&gt;
** Calendar|Resource Scheduling&lt;br /&gt;
** Forms|Sample Submission&lt;br /&gt;
&lt;br /&gt;
* Equipment Resources&lt;br /&gt;
** RT_PCR|RT PCR&lt;br /&gt;
** HCSCellomics|High Throughput Screening&lt;br /&gt;
** NanoString|NanoString&lt;br /&gt;
** Lab_Usage_Plan|Lab Usage Plan&lt;br /&gt;
&lt;br /&gt;
* Data Related Resources&lt;br /&gt;
** Data_Analysis_Resources|Data Analysis&lt;br /&gt;
** Microarray_data_submit_Guide_GEO|NCBI Data Submission Guide&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=18132</id>
		<title>MediaWiki:Sidebar</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=18132"/>
				<updated>2010-12-28T18:54:33Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;* navigation&lt;br /&gt;
** mainpage|Genome Core Home&lt;br /&gt;
** Services|Services&lt;br /&gt;
** Pricing|Pricing&lt;br /&gt;
** Personnel|Personnel&lt;br /&gt;
** Calendar|Resource Scheduling&lt;br /&gt;
** Forms|Sample Submission&lt;br /&gt;
&lt;br /&gt;
* Equipment Resources&lt;br /&gt;
** RT_PCR|RT PCR&lt;br /&gt;
** Lab_Usage_Plan|Lab Usage Plan&lt;br /&gt;
** HCSCellomics|High Throughput Screening&lt;br /&gt;
** NanoString|NanoString&lt;br /&gt;
** Agilent Microarray Scanner&lt;br /&gt;
&lt;br /&gt;
* Data Related Resources&lt;br /&gt;
** Data_Analysis_Resources|Data Analysis&lt;br /&gt;
** Microarray_data_submit_Guide_GEO|NCBI Data Submission Guide&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=18131</id>
		<title>MediaWiki:Sidebar</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=18131"/>
				<updated>2010-12-28T18:54:05Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;* navigation&lt;br /&gt;
** mainpage|Genome Core Home&lt;br /&gt;
** Services|Services&lt;br /&gt;
** Pricing|Pricing&lt;br /&gt;
** Personnel|Personnel&lt;br /&gt;
** Calendar|Resource Scheduling&lt;br /&gt;
** Forms|Sample Submission&lt;br /&gt;
&lt;br /&gt;
* Equipment Resources&lt;br /&gt;
** RT_PCR|RT PCR&lt;br /&gt;
** Lab_Usage_Plan|Lab Usage Plan&lt;br /&gt;
** HCSCellomics|High Throughput Screening&lt;br /&gt;
** NanoString|NanoString&lt;br /&gt;
** Agilent Microarray Scanner&lt;br /&gt;
&lt;br /&gt;
* Data Related Resources&lt;br /&gt;
** RT_PCR|RT PCR&lt;br /&gt;
** Lab_Usage_Plan|Lab Usage Plan&lt;br /&gt;
** HCSCellomics|High Throughput Screening&lt;br /&gt;
** NanoString|NanoString&lt;br /&gt;
** Agilent Microarray Scanner&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=18130</id>
		<title>MediaWiki:Sidebar</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=18130"/>
				<updated>2010-12-28T18:53:21Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;* navigation&lt;br /&gt;
** mainpage|Genome Core Home&lt;br /&gt;
** Services|Services&lt;br /&gt;
** Pricing|Pricing&lt;br /&gt;
** Personnel|Personnel&lt;br /&gt;
** Calendar|Resource Scheduling&lt;br /&gt;
** Forms|Sample Submission&lt;br /&gt;
&lt;br /&gt;
* Equipment Resources&lt;br /&gt;
** RT_PCR|RT PCR&lt;br /&gt;
** Lab_Usage_Plan|Lab Usage Plan&lt;br /&gt;
** HCSCellomics|High Throughput Screening&lt;br /&gt;
** NanoString|NanoString&lt;br /&gt;
** Agilent Microarray Scanner&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=18129</id>
		<title>MediaWiki:Sidebar</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=18129"/>
				<updated>2010-12-28T18:52:57Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;* navigation&lt;br /&gt;
** mainpage|Genome Core Home&lt;br /&gt;
** Services|Services&lt;br /&gt;
** Pricing|Pricing&lt;br /&gt;
** Personnel|Personnel&lt;br /&gt;
** Calendar|Resource Scheduling&lt;br /&gt;
** Forms|Sample Submission&lt;br /&gt;
&lt;br /&gt;
* Equipment Resources&lt;br /&gt;
* RT_PCR|RT PCR&lt;br /&gt;
* Lab_Usage_Plan|Lab Usage Plan&lt;br /&gt;
* HCSCellomics|High Throughput Screening&lt;br /&gt;
* NanoString|NanoString&lt;br /&gt;
* Agilent Microarray Scanner&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=Main_Page&amp;diff=18046</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=Main_Page&amp;diff=18046"/>
				<updated>2010-08-19T16:10:43Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;font-style:italic; font-size:120%; width:100%; border:2px solid white; height:100px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|- &lt;br /&gt;
| [[image:banner.jpg|center]]&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;border:1px solid red; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
| &amp;lt;h3 align=&amp;quot;center&amp;quot;&amp;gt; [[HCSCellomics|Cellomics High Throughput Screeing Available]] &amp;lt;/h3&amp;gt;&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
{| style=&amp;quot;background:white; color:black; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
{|&lt;br /&gt;
|&lt;br /&gt;
{| style=&amp;quot;background:white; color:black; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:400px; height:170px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | [[Services]]&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:100%&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
* [[Sequencing]] - ChIP, Small RNA, mRNA, Denovo, Paired End and others&lt;br /&gt;
* [[Microarray_Analysis|Microarrays]] - ChIP, mRNA, miRNA and CGH&lt;br /&gt;
* Others - BioAnalyzer Sample QC&lt;br /&gt;
{| style=&amp;quot;border:1px solid green; background: #0000FF; color: white; text-align: center; width:100%&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
| [[Forms|&amp;lt;span style=&amp;quot;color:white;&amp;quot;&amp;gt;'''Sample Submission Forms For All Services'''&amp;lt;/span&amp;gt;]]&lt;br /&gt;
|}&lt;br /&gt;
{| style=&amp;quot;border:1px solid green; background: #0000FF; color: white; text-align: center; width:100%&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
| [[Pricing|&amp;lt;span style=&amp;quot;color:white;&amp;quot;&amp;gt;'''Pricing for all services'''&amp;lt;/span&amp;gt;]]&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
||&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:400px; height:170px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Tools and Resources&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:100%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
* Resources - [[RT_PCR|RT PCR]], [[Lab_Usage_Plan|Lab Usage Plan]], [[HCSCellomics|High Throughput Screening]], Agilent Microarray Scanner&lt;br /&gt;
* Others - [[Protocols|Protocols]], [[Freq_asked_questions|FAQ's]], [[Ozone|Ozone Map]], [[Data_Analysis_Resources|Data Analysis]], [[Microarray_data_submit_Guide_GEO|NCBI Data Submission Guide]]&lt;br /&gt;
{| style=&amp;quot;border:1px solid green; background: #0000FF; color: white; text-align: center; width:100%&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
| [[Calendar|&amp;lt;span style=&amp;quot;color:white;&amp;quot;&amp;gt;'''Resource Scheduling Systems for Agilent Microarray Scanner, Cellomics and RT PCR'''&amp;lt;/span&amp;gt;]]&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
{| style=&amp;quot;background:white; color:black; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:400px; height:120px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Contact Us&lt;br /&gt;
{| style=&amp;quot;text-align: center; width:100%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
9 Cambridge Center, &amp;lt;br&amp;gt; &lt;br /&gt;
Cambridge, MA - 02142 &amp;lt;br&amp;gt;&lt;br /&gt;
Tel: 617-258-8803 &amp;lt;br&amp;gt;&lt;br /&gt;
[[wibr-genome at wi dot mit dot edu]]&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
||&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:400px; height:120px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Other General Information&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:100%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
* [[Personnel]] - [[Tom_Volkert|Tom Volkert]], [[Jennifer_Love|Jennifer Love]], [[Sumeet_Gupta|Sumeet Gupta]], [[Jeong-Ah_Kwon|Jeong-Ah Kwon]], [[Vidya_Dhanapal| Vidya Dhanapal]]&lt;br /&gt;
* [[Equipment_Resources|Equipment]]&lt;br /&gt;
* [[General_Links_Resources|General Links]]&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=Services&amp;diff=18017</id>
		<title>Services</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=Services&amp;diff=18017"/>
				<updated>2010-07-02T15:55:11Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;=Sequencing=&lt;br /&gt;
The GTC has two high-throughput Solexa Genome Analyzers 2.0 (Illumina), which are currently being used for a variety of applications, including ChIP-Seq, miRNA sequencing and expression sequencing. Each next-generation sequencer can process up to 16 samples per week, with a data yield of approximately 10 million reads per sample. Read lengths are 17, 26 or 36 bases. This sequencing technology consists of binding randomly fragmented DNA to an optical flowcell . &lt;br /&gt;
&lt;br /&gt;
==[[ChIP_Seq| ChIP-Seq]] ==&lt;br /&gt;
ChIP-Sequencing (or ChIP-Seq) combines chromatin immunoprecipitation (ChIP) with DNA sequencing, allowing researchers to identify the binding sites of DNA-associated proteins. It can be used as an alternative to promoter or whole genome microarray hybridization or qPCR. http://illumina.com/downloads/ChIP-Seq_DataSheet.pdf &lt;br /&gt;
&lt;br /&gt;
[[ChIP_Seq| More Details...]]&lt;br /&gt;
&lt;br /&gt;
==[[Genome_Seq| Genome sequencing and resequencing]] == &lt;br /&gt;
De novo sequencing can be done using the Genome Analyzer, although the short read lengths can make assembly challenging, especially in larger genomes. &lt;br /&gt;
&lt;br /&gt;
[[Genome_Seq| More Details...]]&lt;br /&gt;
&lt;br /&gt;
==[[PEM| Paired-end sequencing]] ==&lt;br /&gt;
The paired-end module of the GAII system allows both ends of a DNA fragment to be sequenced. This gives more specificity to alignment algorithms, especially in highly repetitive regions. The paired-end module allows for up to 36 bases of each end to be sequenced during the same sequencing run.&lt;br /&gt;
&lt;br /&gt;
[[PEM| More Details...]]&lt;br /&gt;
&lt;br /&gt;
==[[Expression_Seq| Digital gene expression or RNA-Seq]] == &lt;br /&gt;
We offer a mRNA Sequencing service utilizing the Genome Analyzer System (Solexa) from Illumina. Primarily, we offer: &lt;br /&gt;
&lt;br /&gt;
Digital Gene Expression Sequencing Service: Digital Gene Expression is similar to SAGE analysis. &lt;br /&gt;
&lt;br /&gt;
Whole Transcriptome Analysis: Sequencing the entire transcriptome can reveal valuable information about exon boundaries and splice variants that may be missed by microarray analysis or Digital Gene Expression. Kits for whole transcriptome analysis are expected to be available from Illumina soon. &lt;br /&gt;
&lt;br /&gt;
[[Expression_Seq| More Details...]]&lt;br /&gt;
&lt;br /&gt;
==[[Small_RNA_Seq| Small RNA discovery]] ==&lt;br /&gt;
Small RNA discovery provides identification of non-coding RNA to aid in the understanding of gene regulation. It can be helpful in identifying novel small RNA molecules. &lt;br /&gt;
&lt;br /&gt;
[[Small_RNA_Seq| More Details...]]&lt;br /&gt;
&lt;br /&gt;
=Microarray=&lt;br /&gt;
&lt;br /&gt;
== [[Expression_Analysis_Services| Expression Analysis]] ==&lt;br /&gt;
We offer a Expression Analysis Service utilizing the 3 Plaforms - Agilent, Affymetrix and Custom Arrays.&lt;br /&gt;
&lt;br /&gt;
[[Expression_Analysis_Services| More Details...]]&lt;br /&gt;
&lt;br /&gt;
== [[ChIP_on_Chip| ChIP on Chip/Location Analysis]] ==&lt;br /&gt;
ChIP-Chip (Chromatin IP on Chip, also called Genome Wide Location Analysis) is a method for studying the regulation of gene expression on a genome-wide scale. We offer labeling, hybridization and prelimary analysis services for 2 platforms - Agilent and Affymetrix.&lt;br /&gt;
&lt;br /&gt;
[[ChIP_on_Chip| More Details...]]&lt;br /&gt;
&lt;br /&gt;
== [[MiRNA_Services| miRNA Analysis]] ==&lt;br /&gt;
We offer a microRNA expression profiling service utilizing a microarray detection system that was developed specifically for microRNA detection. &lt;br /&gt;
&lt;br /&gt;
[[MiRNA_Services| More Details...]]&lt;br /&gt;
&lt;br /&gt;
== [[Array_Manufacturing| Array Manufacturing]]==&lt;br /&gt;
The Center of Microarray Technology can assist in the design, preparation and analysis of custom microarrays. &lt;br /&gt;
&lt;br /&gt;
[[Array_Manufacturing| More Details...]]&lt;br /&gt;
&lt;br /&gt;
=Other Services=&lt;br /&gt;
&lt;br /&gt;
==[[RT_PCR| RT PCR]]==&lt;br /&gt;
The GTC features the 7900HT Fast Real-Time PCR system from Applied Biosystems for quantitative PCR. This highly flexible system supports both 96 and 384 well plate formats as well as the TLDA (TaqMan Low Density Array) card format. &lt;br /&gt;
&lt;br /&gt;
[[RT_PCR| More Details...]]&lt;br /&gt;
&lt;br /&gt;
== Lab Use ==&lt;br /&gt;
The GTC offers Whitehead community members the opportunity to take advantage of our equipment for a nominal monthly charge of $250 per lab.&lt;br /&gt;
&lt;br /&gt;
[[Lab_Usage_Plan| More Details...]]&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=Services&amp;diff=18016</id>
		<title>Services</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=Services&amp;diff=18016"/>
				<updated>2010-07-02T15:55:06Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;=Sequencing=&lt;br /&gt;
The GTC has two high-throughput Solexa Genome Analyzers 2.0 (Illumina), which are currently being used for a variety of applications, including ChIP-Seq, miRNA sequencing and expression sequencing. Each next-generation sequencer can process up to 16 samples per week, with a data yield of approximately 10 million reads per sample. Read lengths are 17, 26 or 36 bases. This sequencing technology consists of binding randomly fragmented DNA to an optical flowcell . &lt;br /&gt;
&lt;br /&gt;
==[[ChIP_Seq| ChIP-Seq]] ==&lt;br /&gt;
ChIP-Sequencing (or ChIP-Seq) combines chromatin immunoprecipitation (ChIP) with DNA sequencing, allowing researchers to identify the binding sites of DNA-associated proteins. It can be used as an alternative to promoter or whole genome microarray hybridization or qPCR. http://illumina.com/downloads/ChIP-Seq_DataSheet.pdf &lt;br /&gt;
&lt;br /&gt;
[[ChIP_Seq| More Details...]]&lt;br /&gt;
&lt;br /&gt;
==[[Genome_Seq| Genome sequencing and resequencing]] == &lt;br /&gt;
De novo sequencing can be done using the Genome Analyzer, although the short read lengths can make assembly challenging, especially in larger genomes. &lt;br /&gt;
&lt;br /&gt;
[[Genome_Seq| More Details...]]&lt;br /&gt;
&lt;br /&gt;
==[[PEM| Paired-end sequencing]] ==&lt;br /&gt;
The paired-end module of the GAII system allows both ends of a DNA fragment to be sequenced. This gives more specificity to alignment algorithms, especially in highly repetitive regions. The paired-end module allows for up to 36 bases of each end to be sequenced during the same sequencing run.&lt;br /&gt;
d&lt;br /&gt;
[[PEM| More Details...]]&lt;br /&gt;
&lt;br /&gt;
==[[Expression_Seq| Digital gene expression or RNA-Seq]] == &lt;br /&gt;
We offer a mRNA Sequencing service utilizing the Genome Analyzer System (Solexa) from Illumina. Primarily, we offer: &lt;br /&gt;
&lt;br /&gt;
Digital Gene Expression Sequencing Service: Digital Gene Expression is similar to SAGE analysis. &lt;br /&gt;
&lt;br /&gt;
Whole Transcriptome Analysis: Sequencing the entire transcriptome can reveal valuable information about exon boundaries and splice variants that may be missed by microarray analysis or Digital Gene Expression. Kits for whole transcriptome analysis are expected to be available from Illumina soon. &lt;br /&gt;
&lt;br /&gt;
[[Expression_Seq| More Details...]]&lt;br /&gt;
&lt;br /&gt;
==[[Small_RNA_Seq| Small RNA discovery]] ==&lt;br /&gt;
Small RNA discovery provides identification of non-coding RNA to aid in the understanding of gene regulation. It can be helpful in identifying novel small RNA molecules. &lt;br /&gt;
&lt;br /&gt;
[[Small_RNA_Seq| More Details...]]&lt;br /&gt;
&lt;br /&gt;
=Microarray=&lt;br /&gt;
&lt;br /&gt;
== [[Expression_Analysis_Services| Expression Analysis]] ==&lt;br /&gt;
We offer a Expression Analysis Service utilizing the 3 Plaforms - Agilent, Affymetrix and Custom Arrays.&lt;br /&gt;
&lt;br /&gt;
[[Expression_Analysis_Services| More Details...]]&lt;br /&gt;
&lt;br /&gt;
== [[ChIP_on_Chip| ChIP on Chip/Location Analysis]] ==&lt;br /&gt;
ChIP-Chip (Chromatin IP on Chip, also called Genome Wide Location Analysis) is a method for studying the regulation of gene expression on a genome-wide scale. We offer labeling, hybridization and prelimary analysis services for 2 platforms - Agilent and Affymetrix.&lt;br /&gt;
&lt;br /&gt;
[[ChIP_on_Chip| More Details...]]&lt;br /&gt;
&lt;br /&gt;
== [[MiRNA_Services| miRNA Analysis]] ==&lt;br /&gt;
We offer a microRNA expression profiling service utilizing a microarray detection system that was developed specifically for microRNA detection. &lt;br /&gt;
&lt;br /&gt;
[[MiRNA_Services| More Details...]]&lt;br /&gt;
&lt;br /&gt;
== [[Array_Manufacturing| Array Manufacturing]]==&lt;br /&gt;
The Center of Microarray Technology can assist in the design, preparation and analysis of custom microarrays. &lt;br /&gt;
&lt;br /&gt;
[[Array_Manufacturing| More Details...]]&lt;br /&gt;
&lt;br /&gt;
=Other Services=&lt;br /&gt;
&lt;br /&gt;
==[[RT_PCR| RT PCR]]==&lt;br /&gt;
The GTC features the 7900HT Fast Real-Time PCR system from Applied Biosystems for quantitative PCR. This highly flexible system supports both 96 and 384 well plate formats as well as the TLDA (TaqMan Low Density Array) card format. &lt;br /&gt;
&lt;br /&gt;
[[RT_PCR| More Details...]]&lt;br /&gt;
&lt;br /&gt;
== Lab Use ==&lt;br /&gt;
The GTC offers Whitehead community members the opportunity to take advantage of our equipment for a nominal monthly charge of $250 per lab.&lt;br /&gt;
&lt;br /&gt;
[[Lab_Usage_Plan| More Details...]]&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=Calendar&amp;diff=17933</id>
		<title>Calendar</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=Calendar&amp;diff=17933"/>
				<updated>2010-01-21T16:11:56Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{TopRightSideBar|&lt;br /&gt;
|title=Instrument Calendar&lt;br /&gt;
|image=Calendar.jpg&lt;br /&gt;
|subtitle=Instrument Calendar&lt;br /&gt;
|highlights=    &lt;br /&gt;
&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
== Agilent Scanner Scheduling Calendar ==&lt;br /&gt;
&lt;br /&gt;
* Login using your Whitehead Email Account.&lt;br /&gt;
* Name of the calendar is &amp;quot;agilent-scanner&amp;quot;&lt;br /&gt;
&lt;br /&gt;
'''Instructions'''&lt;br /&gt;
&lt;br /&gt;
To View Calendar: https://mars.wi.mit.edu/home/agilent-scanner@wi.mit.edu/Calendar.html [LOGIN USING WI USERNAME AND PASSWORD]. &lt;br /&gt;
&lt;br /&gt;
To book a slot on the calendar (External customers, please contact us directly): You can use the same system as the FACS machine i.e. using the zimbra web interface. Instructions on reserving a resource using Zimbra:&lt;br /&gt;
&lt;br /&gt;
1.	Login to the Zimbra web client, https://mars.wi.mit.edu&lt;br /&gt;
&lt;br /&gt;
2.	Select the calendar tab and then click New, this will take you to an appointment screen. If you only see a “Quick Add Appointment” dialog box, click the “more details …” button in the bottom left of the box.&lt;br /&gt;
&lt;br /&gt;
3.	The Subject should contain your Name, Lab and phone number. Set the start and end times according to your needs.&lt;br /&gt;
&lt;br /&gt;
4.	 Add the equipment by clicking on the “Find Resources” tab. You can type the name Calendar Name and then the Search button, if you don’t know the name the Search button alone will list all Resources. Verify the equipment is available during your meeting time by looking in the status column. A BUSY means the equipment is already reserved at that time, you will need to find a different time for your meeting. If the equipment is Free, select it and click add, this will invite the equipment to the meeting.&lt;br /&gt;
&lt;br /&gt;
5.	Save the meeting! You will receive an email verification of the appointment. The meeting will now be on your own calendar and the equipment calendar. The equipment will respond immediately with confirmation if it’s available. &lt;br /&gt;
&lt;br /&gt;
6.	If your meeting does not update on the calendar, click the refresh button on the toolbar directly above your calendar.&lt;br /&gt;
&lt;br /&gt;
== Cellomics Scheduling Calendar | [[HCSCellomics|Service Details]] ==&lt;br /&gt;
[https://mars.wi.mit.edu/home/hcs-cellomics/Calendar.html Calendar to Book Cellomics in Rm 325] &lt;br /&gt;
&lt;br /&gt;
* Login using your Whitehead Email Account.&lt;br /&gt;
* Name of the calendar is &amp;quot;hcs-cellomics&amp;quot;&lt;br /&gt;
&lt;br /&gt;
'''Instructions'''&lt;br /&gt;
&lt;br /&gt;
Same as agilent scanner.&lt;br /&gt;
&lt;br /&gt;
== ABI7900 (QPCR/RTPCR) Scheduling System | [[RT_PCR|Service Details]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt; Whitehead Network Access Required, Please contact us if you do not have access to whitehead network&amp;lt;/font&amp;gt; &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
* [http://iona.wi.mit.edu/microarray/instrumentuse/qpcrusage.php Book a time slot to use the ABI 7900 Machines] &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
* [http://iona.wi.mit.edu/microarray/solexa/login.php Edit or delete booked slots for ABI 7900 Machines] (This requires a login and password)&lt;br /&gt;
** Add run details like number of plates, ul of master mix etc. for a scheduled block, for billing purposes.&lt;br /&gt;
** Delete scheduled blocks.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
* [http://iona.wi.mit.edu/microarray/instrumentuse/abischedulesearch.php Schedule for the ABI 7900] &amp;lt;br&amp;gt;&lt;br /&gt;
** View upcoming schedule.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''Step By Step Instructions'''&lt;br /&gt;
&lt;br /&gt;
Step 1: New users - [http://iona.wi.mit.edu/microarray/solexa/register.php Register]. Returning users go to step 2.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
Step 2: Book a time slot using the [http://iona.wi.mit.edu/microarray/instrumentuse/qpcrusage.php Online ABI 7900 Booking Form]. Once you select a instrument, date and block/time slot, the system would show you immediately if the block/time slot is available or not.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
Step 3: If you do not want to use the time slot, delete it using the [http://iona.wi.mit.edu/microarray/solexa/login.php edit/delete interface] (Username and password required). You will only be able to delete time slots registered under your name.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
Step 4: If you want to swap your time slot with someone else, you can view the [http://iona.wi.mit.edu/microarray/instrumentuse/abischedulesearch.php Schedule for the ABI 7900].&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
Step 5: If you used any reagents or plates provided by the core, please log them using the [http://iona.wi.mit.edu/microarray/solexa/login.php edit/delete interface] (Username and password required).&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=Calendar&amp;diff=17932</id>
		<title>Calendar</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=Calendar&amp;diff=17932"/>
				<updated>2010-01-21T16:11:03Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{TopRightSideBar|&lt;br /&gt;
|title=Instrument Calendar&lt;br /&gt;
|image=Calendar.jpg&lt;br /&gt;
|subtitle=Instrument Calendar&lt;br /&gt;
|highlights=    &lt;br /&gt;
&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
== Agilent Scanner Scheduling Calendar ==&lt;br /&gt;
&lt;br /&gt;
* Login using your Whitehead Email Account.&lt;br /&gt;
* Name of the calendar is &amp;quot;agilent-scanner&amp;quot;&lt;br /&gt;
&lt;br /&gt;
'''Instructions'''&lt;br /&gt;
&lt;br /&gt;
To View Calendar: https://mars.wi.mit.edu/home/agilent-scanner@wi.mit.edu/Calendar.html [LOGIN USING WI USERNAME AND PASSWORD]. &lt;br /&gt;
&lt;br /&gt;
To book a slot on the calendar (External customers, please contact us directly): You can use the same system as the FACS machine i.e. using the zimbra web interface. Instructions on reserving a resource using Zimbra:&lt;br /&gt;
&lt;br /&gt;
1.	Login to the Zimbra web client, https://mars.wi.mit.edu&lt;br /&gt;
&lt;br /&gt;
2.	Select the calendar tab and then click New, this will take you to an appointment screen. If you only see a “Quick Add Appointment” dialog box, click the “more details …” button in the bottom left of the box.&lt;br /&gt;
&lt;br /&gt;
3.	The Subject should contain your Name, Lab and phone number. Set the start and end times according to your needs.&lt;br /&gt;
&lt;br /&gt;
4.	 Add the equipment by clicking on the “Find Resources” tab. You can type the name Calendar Name and then the Search button, if you don’t know the name the Search button alone will list all Resources. Verify the equipment is available during your meeting time by looking in the status column. A BUSY means the equipment is already reserved at that time, you will need to find a different time for your meeting. If the equipment is Free, select it and click add, this will invite the equipment to the meeting.&lt;br /&gt;
&lt;br /&gt;
5.	Save the meeting! You will receive an email verification of the appointment. The meeting will now be on your own calendar and the equipment calendar. The equipment will respond immediately with confirmation if it’s available. &lt;br /&gt;
&lt;br /&gt;
6.	If your meeting does not update on the calendar, click the refresh button on the toolbar directly above your calendar.&lt;br /&gt;
&lt;br /&gt;
== Cellomics Scheduling Calendar | [[HCSCellomics|Service Details]] ==&lt;br /&gt;
[https://mars.wi.mit.edu/home/hcs-cellomics/Calendar.html Calendar to Book Cellomics in Rm 325] &lt;br /&gt;
&lt;br /&gt;
* Login using your Whitehead Email Account.&lt;br /&gt;
* Name of the calendar is &amp;quot;hcs-cellomics&amp;quot;&lt;br /&gt;
&lt;br /&gt;
'''Instructions'''&lt;br /&gt;
&lt;br /&gt;
Same as agilent scanner.&lt;br /&gt;
&lt;br /&gt;
== ABI7900 Scheduling System | [[RT_PCR|Service Details]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt; Whitehead Network Access Required, Please contact us if you do not have access to whitehead network&amp;lt;/font&amp;gt; &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
* [http://iona.wi.mit.edu/microarray/instrumentuse/qpcrusage.php Book a time slot to use the ABI 7900 Machines] &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
* [http://iona.wi.mit.edu/microarray/solexa/login.php Edit or delete booked slots for ABI 7900 Machines] (This requires a login and password)&lt;br /&gt;
** Add run details like number of plates, ul of master mix etc. for a scheduled block, for billing purposes.&lt;br /&gt;
** Delete scheduled blocks.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
* [http://iona.wi.mit.edu/microarray/instrumentuse/abischedulesearch.php Schedule for the ABI 7900] &amp;lt;br&amp;gt;&lt;br /&gt;
** View upcoming schedule.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''Step By Step Instructions'''&lt;br /&gt;
&lt;br /&gt;
Step 1: New users - [http://iona.wi.mit.edu/microarray/solexa/register.php Register]. Returning users go to step 2.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
Step 2: Book a time slot using the [http://iona.wi.mit.edu/microarray/instrumentuse/qpcrusage.php Online ABI 7900 Booking Form]. Once you select a instrument, date and block/time slot, the system would show you immediately if the block/time slot is available or not.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
Step 3: If you do not want to use the time slot, delete it using the [http://iona.wi.mit.edu/microarray/solexa/login.php edit/delete interface] (Username and password required). You will only be able to delete time slots registered under your name.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
Step 4: If you want to swap your time slot with someone else, you can view the [http://iona.wi.mit.edu/microarray/instrumentuse/abischedulesearch.php Schedule for the ABI 7900].&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
Step 5: If you used any reagents or plates provided by the core, please log them using the [http://iona.wi.mit.edu/microarray/solexa/login.php edit/delete interface] (Username and password required).&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=Calendar&amp;diff=17931</id>
		<title>Calendar</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=Calendar&amp;diff=17931"/>
				<updated>2010-01-21T16:10:21Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{TopRightSideBar|&lt;br /&gt;
|title=Instrument Calendar&lt;br /&gt;
|image=Calendar.jpg&lt;br /&gt;
|subtitle=Instrument Calendar&lt;br /&gt;
|highlights=    &lt;br /&gt;
&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
== Agilent Scanner Scheduling Calendar ==&lt;br /&gt;
&lt;br /&gt;
* Login using your Whitehead Email Account.&lt;br /&gt;
* Name of the calendar is &amp;quot;agilent-scanner&amp;quot;&lt;br /&gt;
&lt;br /&gt;
'''Instructions'''&lt;br /&gt;
&lt;br /&gt;
To View Calendar: https://mars.wi.mit.edu/home/agilent-scanner@wi.mit.edu/Calendar.html [LOGIN USING WI USERNAME AND PASSWORD]. &lt;br /&gt;
&lt;br /&gt;
To book a slot on the calendar (External customers, please contact us directly): You can use the same system as the FACS machine i.e. using the zimbra web interface. Instructions on reserving a resource using Zimbra:&lt;br /&gt;
&lt;br /&gt;
1.	Login to the Zimbra web client, https://mars.wi.mit.edu&lt;br /&gt;
&lt;br /&gt;
2.	Select the calendar tab and then click New, this will take you to an appointment screen. If you only see a “Quick Add Appointment” dialog box, click the “more details …” button in the bottom left of the box.&lt;br /&gt;
&lt;br /&gt;
3.	The Subject should contain your Name, Lab and phone number. Set the start and end times according to your needs.&lt;br /&gt;
&lt;br /&gt;
4.	 Add the equipment by clicking on the “Find Resources” tab. You can type the name Calendar Name and then the Search button, if you don’t know the name the Search button alone will list all Resources. Verify the equipment is available during your meeting time by looking in the status column. A BUSY means the equipment is already reserved at that time, you will need to find a different time for your meeting. If the equipment is Free, select it and click add, this will invite the equipment to the meeting.&lt;br /&gt;
&lt;br /&gt;
5.	Save the meeting! You will receive an email verification of the appointment. The meeting will now be on your own calendar and the equipment calendar. The equipment will respond immediately with confirmation if it’s available. &lt;br /&gt;
&lt;br /&gt;
6.	If your meeting does not update on the calendar, click the refresh button on the toolbar directly above your calendar.&lt;br /&gt;
&lt;br /&gt;
== Cellomics Scheduling Calendar [[HCSCellomics|Service Details]] ==&lt;br /&gt;
[https://mars.wi.mit.edu/home/hcs-cellomics/Calendar.html Calendar to Book Cellomics in Rm 325] &lt;br /&gt;
&lt;br /&gt;
* Login using your Whitehead Email Account.&lt;br /&gt;
* Name of the calendar is &amp;quot;hcs-cellomics&amp;quot;&lt;br /&gt;
&lt;br /&gt;
'''Instructions'''&lt;br /&gt;
&lt;br /&gt;
Same as agilent scanner.&lt;br /&gt;
&lt;br /&gt;
== ABI7900 Scheduling System [[RT_PCR|Service Details]] ==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt; Whitehead Network Access Required, Please contact us if you do not have access to whitehead network&amp;lt;/font&amp;gt; &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
* [http://iona.wi.mit.edu/microarray/instrumentuse/qpcrusage.php Book a time slot to use the ABI 7900 Machines] &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
* [http://iona.wi.mit.edu/microarray/solexa/login.php Edit or delete booked slots for ABI 7900 Machines] (This requires a login and password)&lt;br /&gt;
** Add run details like number of plates, ul of master mix etc. for a scheduled block, for billing purposes.&lt;br /&gt;
** Delete scheduled blocks.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
* [http://iona.wi.mit.edu/microarray/instrumentuse/abischedulesearch.php Schedule for the ABI 7900] &amp;lt;br&amp;gt;&lt;br /&gt;
** View upcoming schedule.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
'''Step By Step Instructions'''&lt;br /&gt;
&lt;br /&gt;
Step 1: New users - [http://iona.wi.mit.edu/microarray/solexa/register.php Register]. Returning users go to step 2.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
Step 2: Book a time slot using the [http://iona.wi.mit.edu/microarray/instrumentuse/qpcrusage.php Online ABI 7900 Booking Form]. Once you select a instrument, date and block/time slot, the system would show you immediately if the block/time slot is available or not.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
Step 3: If you do not want to use the time slot, delete it using the [http://iona.wi.mit.edu/microarray/solexa/login.php edit/delete interface] (Username and password required). You will only be able to delete time slots registered under your name.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
Step 4: If you want to swap your time slot with someone else, you can view the [http://iona.wi.mit.edu/microarray/instrumentuse/abischedulesearch.php Schedule for the ABI 7900].&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
Step 5: If you used any reagents or plates provided by the core, please log them using the [http://iona.wi.mit.edu/microarray/solexa/login.php edit/delete interface] (Username and password required).&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=17930</id>
		<title>MediaWiki:Sidebar</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=17930"/>
				<updated>2010-01-21T16:07:58Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;* navigation&lt;br /&gt;
** mainpage|Genome Core Home&lt;br /&gt;
** Services|Services&lt;br /&gt;
** Protocols|Protocols&lt;br /&gt;
** Pricing|Pricing&lt;br /&gt;
** Personnel|Personnel&lt;br /&gt;
** Freq_asked_questions|FAQ's&lt;br /&gt;
** Calendar|Resource Scheduling&lt;br /&gt;
** Forms|Sample Submission&lt;br /&gt;
&lt;br /&gt;
* Resources&lt;br /&gt;
** Data_Analysis_Resources|Data Analysis&lt;br /&gt;
** Equipment_Resources|Equipment&lt;br /&gt;
** General_Links_Resources|General Links&lt;br /&gt;
** Ozone|Ozone Map&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=Sumeet_Gupta&amp;diff=17838</id>
		<title>Sumeet Gupta</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=Sumeet_Gupta&amp;diff=17838"/>
				<updated>2009-06-09T22:12:50Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{| style=&amp;quot;text-align: left; width:90%&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
[[image:Sumeet.jpg|right]]&lt;br /&gt;
[[Sumeet_Gupta| Sumeet Gupta]] &amp;lt;br&amp;gt;&lt;br /&gt;
Bioinformatics Analyst, &amp;lt;br&amp;gt;&lt;br /&gt;
Phone: 617-258-8803 &amp;lt;br&amp;gt;&lt;br /&gt;
Email: sgupta at wi dot mit dot edu &amp;lt;br&amp;gt;&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
= Frequently Asked Questions =&lt;br /&gt;
== Solexa Data Processing ==&lt;br /&gt;
=== Is the Phix control useful for the analysis? ===&lt;br /&gt;
&lt;br /&gt;
Yes. The control does allow us to distinguish between a cluster generation/sequencing issue vs a library/sample prep issue. In addition, it is useful to calculate the phasing and prephasing parameters (used to access the sequencing &amp;quot;efficiency&amp;quot;) for the solexa base calling step which assumes a random distribution of bases. If we do not have a random distribution, it would lead to wrong base calls and worse quality scores, eventually leading to loss of data.&lt;br /&gt;
&lt;br /&gt;
== Solexa Quality Scores ==&lt;br /&gt;
=== What is the format of the quality scores files (fasta files)? ===&lt;br /&gt;
&lt;br /&gt;
@4:1:518:715 &amp;lt;br&amp;gt;&lt;br /&gt;
GATACCATAAAAGCTGGATCCTTCTTCAAGCATAA &amp;lt;br&amp;gt;&lt;br /&gt;
+4:1:518:715 &amp;lt;br&amp;gt;&lt;br /&gt;
hhhhhhhhhhhhhhhdhhhhhhhhhhhdRehdhhP &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
@ID &amp;lt;br&amp;gt;&lt;br /&gt;
Sequence &amp;lt;br&amp;gt;&lt;br /&gt;
+ID &amp;lt;br&amp;gt;&lt;br /&gt;
Quality Scores for each base (String of characters) &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== What do the quality scores for each base mean? ===&lt;br /&gt;
&lt;br /&gt;
P(error) - Probability of the base call being incorrect. &amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
{| cellpadding=&amp;quot;2&amp;quot; style=&amp;quot;border:1px solid darkgray;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
|Char||ASCII||Char-64||P(error)&lt;br /&gt;
|-&lt;br /&gt;
|;||59||-5||0.7597&lt;br /&gt;
|-&lt;br /&gt;
|&amp;lt;||60||-4||0.7153&lt;br /&gt;
|-&lt;br /&gt;
|=||61||-3||0.6661&lt;br /&gt;
|-&lt;br /&gt;
|&amp;gt;||62||-2||0.6131&lt;br /&gt;
|-&lt;br /&gt;
|?||63||-1||0.5573&lt;br /&gt;
|-&lt;br /&gt;
|@||64||0||0.5&lt;br /&gt;
|-&lt;br /&gt;
|A||65||1||0.4427&lt;br /&gt;
|-&lt;br /&gt;
|B||66||2||0.3869&lt;br /&gt;
|-&lt;br /&gt;
|C||67||3||0.3339&lt;br /&gt;
|-&lt;br /&gt;
|D||68||4||0.2847&lt;br /&gt;
|-&lt;br /&gt;
|E||69||5||0.2403&lt;br /&gt;
|-&lt;br /&gt;
|F||70||6||0.2008&lt;br /&gt;
|-&lt;br /&gt;
|G||71||7||0.1663&lt;br /&gt;
|-&lt;br /&gt;
|H||72||8||0.1368&lt;br /&gt;
|-&lt;br /&gt;
|I||73||9||0.1118&lt;br /&gt;
|-&lt;br /&gt;
|J||74||10||0.0909&lt;br /&gt;
|-&lt;br /&gt;
|K||75||11||0.0736&lt;br /&gt;
|-&lt;br /&gt;
|L||76||12||0.0594&lt;br /&gt;
|-&lt;br /&gt;
|M||77||13||0.0477&lt;br /&gt;
|-&lt;br /&gt;
|N||78||14||0.0383&lt;br /&gt;
|-&lt;br /&gt;
|O||79||15||0.0307&lt;br /&gt;
|-&lt;br /&gt;
|P||80||16||0.0245&lt;br /&gt;
|-&lt;br /&gt;
|Q||81||17||0.0196&lt;br /&gt;
|-&lt;br /&gt;
|R||82||18||0.0156&lt;br /&gt;
|-&lt;br /&gt;
|S||83||19||0.0124&lt;br /&gt;
|-&lt;br /&gt;
|T||84||20||0.0099&lt;br /&gt;
|-&lt;br /&gt;
|U||85||21||0.0079&lt;br /&gt;
|-&lt;br /&gt;
|V||86||22||0.0063&lt;br /&gt;
|-&lt;br /&gt;
|W||87||23||0.005&lt;br /&gt;
|-&lt;br /&gt;
|X||88||24||0.004&lt;br /&gt;
|-&lt;br /&gt;
|Y||89||25||0.0032&lt;br /&gt;
|-&lt;br /&gt;
|Z||90||26||0.0025&lt;br /&gt;
|-&lt;br /&gt;
|[||91||27||0.002&lt;br /&gt;
|-&lt;br /&gt;
|\||92||28||0.0016&lt;br /&gt;
|-&lt;br /&gt;
|]||93||29||0.0013&lt;br /&gt;
|-&lt;br /&gt;
|^||94||30||0.001&lt;br /&gt;
|-&lt;br /&gt;
|_||95||31||0.0008&lt;br /&gt;
|-&lt;br /&gt;
|`||96||32||0.0006&lt;br /&gt;
|-&lt;br /&gt;
|a||97||33||0.0005&lt;br /&gt;
|-&lt;br /&gt;
|b||98||34||0.0004&lt;br /&gt;
|-&lt;br /&gt;
|c||99||35||0.0003&lt;br /&gt;
|-&lt;br /&gt;
|d||100||36||0.0003&lt;br /&gt;
|-&lt;br /&gt;
|e||101||37||0.0002&lt;br /&gt;
|-&lt;br /&gt;
|f||102||38||0.0002&lt;br /&gt;
|-&lt;br /&gt;
|g||103||39||0.0001&lt;br /&gt;
|-&lt;br /&gt;
|h||104||40||0.0001&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== Is solexa quality same as phred quality scores? ===&lt;br /&gt;
The Solexa quality and Phred quality are asymptotically identical but NOT the same. If the error probability of a base is $e, the Solexa quality $sQ is: &lt;br /&gt;
$sQ = -10 * log($e / (1 - $e)) / log(10);&lt;br /&gt;
&lt;br /&gt;
Solexa quality $sQ can be converted to Phred quality $Q with this formula: &lt;br /&gt;
$Q = 10 * log(1 + 10 ** ($sQ / 10.0)) / log(10); &lt;br /&gt;
&lt;br /&gt;
== Alignment of Next Generation Sequencing Reads ==&lt;br /&gt;
&lt;br /&gt;
=== What is Eland? ===&lt;br /&gt;
ELAND stands for E fficient L arge-Scale A lignment of N ucleotide D atabases. ELAND is a alignment tool developed by Illumina/Solexa which searches a set of large DNA files for a large number of short DNA reads allowing up to 2 errors per match.&lt;br /&gt;
&lt;br /&gt;
=== How can Eland be faster relative to some other alignment programs? ===&lt;br /&gt;
Given a sequence of length N, it can be divided into four subsequences (A, B, C, and D), which are of equal (or nearly equal length). Assuming there are no more than 2 errors, at least two of these subsequences will be &amp;quot;error free&amp;quot;, so that the two error free sequences can then be searched for in a database containing all possible subsequences in the genome of interest. Thus, you can search your database for the subsequence AB and CD. Searching for the {AB and CD} subsequences would only work if the first half of your sequence has no errors. What if B and C had the errors? The answer is to shuffle your subsequences to make other combinations: ({AB and CD}, {AC and BD}, {AD and CD}, {BA and CD}, etc.). This still provides you with a relatively small search space for each sequence, as there are only 4! possible combinations (which is 4x3x2x1 = 24 possible sequences) to search for. This can be bound even further because the first pair and second pair are in the correct order, (ie {AB and CD} and {AC and BD} are ok, but {CA and DB} and {BA and DC} would give you an incorrect result) limiting you to only six possible combinations, which still allows you to find any correct match where at least two of the four subsequences are error free.&lt;br /&gt;
&lt;br /&gt;
Combining these subsequences into 2 subsets rather than searching for 4 independent entries in their database speeds up the process as long as one set matches (matching criteria on the other set can be relaxed, ie, allowing for mismatches). That is to say, if you make two sequences out of the 4 subsequences {AB and CD}, you can search for an exact match for AB, and test all the possible results for mismatches in the {CD} portion of the sequence. This has the effect of significantly reducing the search space. (Only sequences containing the exact match to {AB})&lt;br /&gt;
&lt;br /&gt;
=== Are their other alignment programs? ===&lt;br /&gt;
* '''Iterative ELAND''' - This algorithm, developed at the core by Sumeet Gupta, iteratively checks shorter reads to attempt to recover non-matching reads. (Currently requests are made to Sumeet Gupta for alignments but a stable version would soon be released which would also report positions if read maps at multiple positions).&lt;br /&gt;
&lt;br /&gt;
* '''MAQ''' - Maq stands for Mapping and Assembly with Quality. It builds assembly by mapping short reads to reference sequences. Maq is a project hosted by SourceForge.net. The project page is available at http://sourceforge.net/projects/maq/.&lt;br /&gt;
&lt;br /&gt;
* '''Bowtie''' - Bowtie is an ultrafast, memory-efficient short read aligner. It indexes the genome with a Burrows-Wheeler index to keep its memory footprint small: typically about 2.2 GB for the human genome (2.9 GB for paired-end). It supports alignment policies equivalent to Maq  and SOAP but is substantially faster.&lt;br /&gt;
&lt;br /&gt;
== File Formats ==&lt;br /&gt;
* '''QC File Format Based on Quality Scores''' - http://jura.wi.mit.edu/genomecorewiki/index.php/QCOutputFormat&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=17766</id>
		<title>MediaWiki:Sidebar</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=17766"/>
				<updated>2008-10-14T14:45:57Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;* navigation&lt;br /&gt;
** mainpage|Genome Core Home&lt;br /&gt;
** Services|Services&lt;br /&gt;
** Protocols|Protocols&lt;br /&gt;
** Pricing|Pricing&lt;br /&gt;
** Personnel|Personnel&lt;br /&gt;
** Freq_asked_questions|FAQ's&lt;br /&gt;
** Calendar|Calendar&lt;br /&gt;
** Forms|Sample Submission&lt;br /&gt;
&lt;br /&gt;
* Resources&lt;br /&gt;
** Data_Analysis_Resources|Data Analysis&lt;br /&gt;
** Equipment_Resources|Equipment&lt;br /&gt;
** General_Links_Resources|General Links&lt;br /&gt;
** Ozone|Ozone Map&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=Main_Page&amp;diff=14417</id>
		<title>Main Page</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=Main_Page&amp;diff=14417"/>
				<updated>2008-10-06T21:15:56Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;font-style:italic; font-size:120%; width:100%; border:2px solid white; height:100px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|- &lt;br /&gt;
| [[image:banner.jpg|center]]&lt;br /&gt;
|-&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
{| style=&amp;quot;background:white; color:black; width:800px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
{| style=&amp;quot;text-align:top; width:200px&amp;quot; valign=&amp;quot;top&amp;quot;&lt;br /&gt;
| &lt;br /&gt;
{| style=&amp;quot;border:1px solid red; width:100%&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
[[image:new.gif|40px]]&lt;br /&gt;
NEWS&lt;br /&gt;
|}&lt;br /&gt;
The [http://wi.mit.edu: Whitehead Institute's] Genome Technology Core (Formely, Center for Microarray Technology (WICMT)) now offers Highthroughput Next Generation Sequencing Service using Solexa.&lt;br /&gt;
&lt;br /&gt;
[[Sequencing|More Details on the Sequencing Service]]&lt;br /&gt;
&lt;br /&gt;
[[Services|All Services offered by Genome Technology Core]]&lt;br /&gt;
|}&lt;br /&gt;
||&lt;br /&gt;
{|&lt;br /&gt;
|&lt;br /&gt;
{| style=&amp;quot;background:white; color:black; width:600px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:200px; height:150px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | [[Sequencing]]&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:90%&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
* [[ChIP_Seq|ChIP Seq]]&lt;br /&gt;
* [[Small_RNA_Seq|Small RNA Sequencing]]&lt;br /&gt;
* [[Expression_Seq|RNA Sequencing]]&lt;br /&gt;
* [[Genome_Seq|Genome Sequencing]]&lt;br /&gt;
* [[PEM|Paired End Sequencing]]&lt;br /&gt;
* [[Sequencing|More....]]&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
||&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:200px; height:150px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | [[Microarray Analysis]]&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:90%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
* [[Expression_Analysis_Services|Expression Analysis]]&lt;br /&gt;
* [[ChIP_on_Chip|ChIP on Chip]]&lt;br /&gt;
* [[MiRNA_Services|miRNA Analysis]]&lt;br /&gt;
* [[Array_Manufacturing|Array Manufacturing]]&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
||&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:200px; height:150px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Other Services&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:90%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
* [[RT_PCR|RT PCR]]&lt;br /&gt;
* [[Lab_Usage_Plan|Lab Usage Plan]]&lt;br /&gt;
* [[Liquidhandling|Liquid Handling]]&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
{| style=&amp;quot;background:white; color:black; width:600px&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:200px; height:150px; text-align: center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | [[Personnel]]&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:90%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
* [[Tom_Volkert|Tom Volkert]]&lt;br /&gt;
* [[Jennifer_Love|Jennifer Love]]&lt;br /&gt;
* [[Sumeet_Gupta|Sumeet Gupta]]&lt;br /&gt;
* [[Jeong-Ah_Kwon|Jeong-Ah Kwon]]&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
|&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:200px; height:150px; text-align: center&amp;quot; &lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | [[Quick Links]]&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:90%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
* [[Freq_asked_questions|FAQ's]]&lt;br /&gt;
* [[Forms|Sample Submission Forms]]&lt;br /&gt;
* [[Calendar|Calendar]]&lt;br /&gt;
* [[Ozone|Ozone Map]]&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
|&lt;br /&gt;
{| style=&amp;quot;border:1px solid purple; width:200px; height:150px; text-align: center&amp;quot; &lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Resources&lt;br /&gt;
{| style=&amp;quot;text-align: left; width:90%&amp;quot; &lt;br /&gt;
|&lt;br /&gt;
* [[Data_Analysis_Resources|Data Analysis]]&lt;br /&gt;
* [[Equipment_Resources|Equipment]]&lt;br /&gt;
* [[General_Links_Resources|General Links]]&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
{| style=&amp;quot;background:lemonchiffon; width:100%; text-align: center&amp;quot; align=&amp;quot;center&amp;quot;&lt;br /&gt;
| valign=&amp;quot;top&amp;quot; | Contact Us&lt;br /&gt;
{| &lt;br /&gt;
|&lt;br /&gt;
9 Cambridge Center, Rm 325, Cambridge, MA - 02142 &amp;lt;br&amp;gt;&lt;br /&gt;
Tel: 617-258-8803 &amp;lt;br&amp;gt;&lt;br /&gt;
[[wibr-microarray@wi.mit.edu]]&lt;br /&gt;
|}&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=Freq_asked_questions&amp;diff=14415</id>
		<title>Freq asked questions</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=Freq_asked_questions&amp;diff=14415"/>
				<updated>2008-10-06T21:14:50Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{TopRightSideBar|&lt;br /&gt;
|title=FAQ's&lt;br /&gt;
|image=faq.jpg&lt;br /&gt;
|subtitle=Frequently Asked Questions&lt;br /&gt;
|highlights=    &lt;br /&gt;
&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
== General ==&lt;br /&gt;
&lt;br /&gt;
=== Which platforms do you support for expression analysis? ===&lt;br /&gt;
We support Affymetrix, Agilent and printed arrays from Operon.&lt;br /&gt;
&lt;br /&gt;
=== How do I sign up to use your ABI Prism 700 RT-PCR machine? ===&lt;br /&gt;
To sign up for time on the ABI Prism, please see the calendar  on the desk mat underneath the laptop which runs the  machine. Please note that there are time blocks, which are  explained in a note on the wall by the calendar. These time  blocks include only machine time. Please plan accordingly.&lt;br /&gt;
&lt;br /&gt;
=== Do you have bench/work space for visiting users in the  WICMT laboratory? What about tips, etc? ===&lt;br /&gt;
WICMT has available bench space for visitors to use. We  supply tips and gloves. Please be aware that this bench space,  as well as WICMT refrigerators and freezers, is a “glove zone” –  please wear gloves when handling WICMT tips, reagents, etc.   &lt;br /&gt;
&lt;br /&gt;
=== How is my RNA checked for quality control before processing? ===&lt;br /&gt;
We use Agilent’s Bioanalyzer 2100 for RNA QC. Please see  Agilent’s website for more information.&lt;br /&gt;
&lt;br /&gt;
=== Will I get my samples back after my experiment is complete? ===&lt;br /&gt;
Yes. We will ship your samples and leftover arrays back  to you. Please provide a FedEx number on your sample  submission form.&lt;br /&gt;
&lt;br /&gt;
=== How long can I expect to wait for my project to be  completed? ===&lt;br /&gt;
We pride ourselves on fast turnaround but our project list  can get quite long. At the time of sample submission we will  provide you with an estimate of when the project will be  completed. Expression analysis projects cannot be scheduled until RNA is submitted. Typical wait time for standard service projects is  about 2 weeks.&lt;br /&gt;
&lt;br /&gt;
=== How long does it take? ===&lt;br /&gt;
Please allow 2-4 weeks for completion of the entire analysis from receipt of samples to delivery of the final data. &lt;br /&gt;
&lt;br /&gt;
=== What about unused sample? ===&lt;br /&gt;
&lt;br /&gt;
== Pricing ==&lt;br /&gt;
=== How much does it cost to do a microarray experiment? === &lt;br /&gt;
Please see the Pricing page for our full price list. Please  note that non-WI/MIT academic institutions should add 30%  to the list price. Commercial entities should add 60%. Contact us for  Affymetrix Gene Chip or Agilent catalog array pricing. Quotes are available for larger projects.   Q: How much does it cost to print a custom array? A: Pricing for custom array projects is a function of labor,  equipment time and supplies (slides). Every project is different  and it is often difficult to predict the total costs until the work  is complete. Customers interested in printing custom arrays  should contact Tom Volkert for estimates.    Q: Is there a bulk discount for processing large numbers of  samples? A: Volume discounts are available, contact WICMT for details.&lt;br /&gt;
&lt;br /&gt;
=== How much does the lab use program cost? What does it include? ===&lt;br /&gt;
A monthly fee of $250 covers your lab’s usage of  common equipment, such as the Nanodrop spectrophotometer  and the SpeedVac, and occasional usage of other equipment  as needed. Please note that this monthly lab use fee does NOT  include the ABI Prism 700 RT-PCR machine, Affymetrix  equipment, or the Biomek. To sign your lab up, contact  Jennifer Love with your request. You will begin receiving  monthly invoices from WICMT right away. &lt;br /&gt;
&lt;br /&gt;
== Sample Submission ==&lt;br /&gt;
=== How much RNA do I need to do a microarray experiment? ===&lt;br /&gt;
For the standard one-cycle labeling protocol we request 10ug  total RNA, and an extra 1ug for QC. For the small  sample (two-cycle) labeling protocol, 25-50ng total RNA is  requested. It is always beneficial to supply enough RNA for  two sample preps, if possible. This is just for security. One and two cycle labeling is available for all supported array platforms.&lt;br /&gt;
&lt;br /&gt;
=== How do I submit samples to WICMT for processing? ===&lt;br /&gt;
Please download the Sample Submission Form  on the Forms page. There is no need to submit any secondary forms,  since this form provides your contact information, as well as  information about your samples.   &lt;br /&gt;
&lt;br /&gt;
=== Where can I find the forms I need to submit samples? ===&lt;br /&gt;
See our Forms page for all our submission forms.  &lt;br /&gt;
&lt;br /&gt;
== Shipping ==&lt;br /&gt;
=== How do I ship my RNA to WICMT? ===&lt;br /&gt;
If you are shipping within the U.S., please send your samples  by overnight priority shipping on dry ice. If you are shipping  internationally, please send your samples at room temperature,  precipitated in EtOH and NaOAc according to your lab  protocol. WICMT will chill your samples overnight to precipitate,  and then spin down and resuspend your RNA. In this case, it is imperative that you supply at least double the amount of RNA  you would normally supply.  &lt;br /&gt;
&lt;br /&gt;
=== What’s your shipping address? === &lt;br /&gt;
Please ship your materials to: Jennifer Love, Whitehead Institute Center for Microarray Technology, 9 Cambridge Center, Room 325, Cambridge MA, 02145.&lt;br /&gt;
&lt;br /&gt;
=== How do I ship my Affymetrix Gene Chips to WICMT? ===&lt;br /&gt;
You can ship the Gene Chips at room temperature by  overnight priority shipping. Once here, they will be stored in  our refrigerators. Please write your name on the boxes before  you send them.   &lt;br /&gt;
&lt;br /&gt;
=== How do I drop-ship Affymetrix Gene Chips to WICMT? ===&lt;br /&gt;
A: Because WICMT is a service facility, we have made  arrangements with Affymetrix to allow our customers to order  and pay for Gene Chips themselves, and have the Gene Chips  shipped directly to our laboratory. Please be sure to mention  this arrangement when placing your order. Please have the  chips delivered in your name, care of Jennifer Love. This will make keeping track of arriving chips more efficient. Please see  our shipping address above. WICMT cannot order chips for  customers outside of the Whitehead Institute or MIT.&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=14414</id>
		<title>MediaWiki:Sidebar</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=14414"/>
				<updated>2008-10-06T21:14:27Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;* navigation&lt;br /&gt;
** mainpage|Homepage&lt;br /&gt;
** Services|Services&lt;br /&gt;
** Protocols|Protocols&lt;br /&gt;
** Pricing|Pricing&lt;br /&gt;
** Personnel|Personnel&lt;br /&gt;
** Freq_asked_questions|FAQ's&lt;br /&gt;
** Calendar|Calendar&lt;br /&gt;
** Forms|Sample Submission&lt;br /&gt;
&lt;br /&gt;
* Resources&lt;br /&gt;
** Data_Analysis_Resources|Data Analysis&lt;br /&gt;
** Equipment_Resources|Equipment&lt;br /&gt;
** General_Links_Resources|General Links&lt;br /&gt;
** Ozone|Ozone Map&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=Freq_asked_questions&amp;diff=14413</id>
		<title>Freq asked questions</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=Freq_asked_questions&amp;diff=14413"/>
				<updated>2008-10-06T21:13:52Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;[[faq|FAQ's]]&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=14412</id>
		<title>MediaWiki:Sidebar</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=14412"/>
				<updated>2008-10-06T21:13:05Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;* navigation&lt;br /&gt;
** mainpage|Homepage&lt;br /&gt;
** Services|Services&lt;br /&gt;
** Protocols|Protocols&lt;br /&gt;
** Pricing|Pricing&lt;br /&gt;
** Personnel|Personnel&lt;br /&gt;
** faq|FAQ's&lt;br /&gt;
** Calendar|Calendar&lt;br /&gt;
** Forms|Sample Submission&lt;br /&gt;
&lt;br /&gt;
* Resources&lt;br /&gt;
** Data_Analysis_Resources|Data Analysis&lt;br /&gt;
** Equipment_Resources|Equipment&lt;br /&gt;
** General_Links_Resources|General Links&lt;br /&gt;
** Ozone|Ozone Map&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=14411</id>
		<title>MediaWiki:Sidebar</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=14411"/>
				<updated>2008-10-06T21:12:10Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;* navigation&lt;br /&gt;
** mainpage|Homepage&lt;br /&gt;
** Services|Services&lt;br /&gt;
** Protocols|Protocols&lt;br /&gt;
** Pricing|Pricing&lt;br /&gt;
** Personnel|Personnel&lt;br /&gt;
** Faq|FAQ&lt;br /&gt;
** Calendar|Calendar&lt;br /&gt;
** Forms|Sample Submission&lt;br /&gt;
&lt;br /&gt;
* Resources&lt;br /&gt;
** Data_Analysis_Resources|Data Analysis&lt;br /&gt;
** Equipment_Resources|Equipment&lt;br /&gt;
** General_Links_Resources|General Links&lt;br /&gt;
** Ozone|Ozone Map&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=14410</id>
		<title>MediaWiki:Sidebar</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=14410"/>
				<updated>2008-10-06T21:11:01Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;* navigation&lt;br /&gt;
** mainpage|mainpage&lt;br /&gt;
** Services|Services&lt;br /&gt;
** Protocols|Protocols&lt;br /&gt;
** Pricing|Pricing&lt;br /&gt;
** Personnel|Personnel&lt;br /&gt;
** Faq|Faq&lt;br /&gt;
** Calendar|Calendar&lt;br /&gt;
** Forms|Sample Submission&lt;br /&gt;
&lt;br /&gt;
* Resources&lt;br /&gt;
** Data_Analysis_Resources|Data Analysis&lt;br /&gt;
** Equipment_Resources|Equipment&lt;br /&gt;
** General_Links_Resources|General Links&lt;br /&gt;
** Ozone|Ozone Map&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=14409</id>
		<title>MediaWiki:Sidebar</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=14409"/>
				<updated>2008-10-06T21:10:28Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;* navigation&lt;br /&gt;
** mainpage|mainpage&lt;br /&gt;
** Services|Services&lt;br /&gt;
** Protocols|Protocols&lt;br /&gt;
** Pricing|Pricing&lt;br /&gt;
** Personnel|Personnel&lt;br /&gt;
** faq|Faq&lt;br /&gt;
** Calendar|Calendar&lt;br /&gt;
** Forms|Sample Submission&lt;br /&gt;
&lt;br /&gt;
* Resources&lt;br /&gt;
** Data_Analysis_Resources|Data Analysis&lt;br /&gt;
** Equipment_Resources|Equipment&lt;br /&gt;
** General_Links_Resources|General Links&lt;br /&gt;
** Ozone|Ozone Map&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	<entry>
		<id>http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=13357</id>
		<title>MediaWiki:Sidebar</title>
		<link rel="alternate" type="text/html" href="http://gtc.wi.mit.edu/index.php?title=MediaWiki:Sidebar&amp;diff=13357"/>
				<updated>2008-10-05T23:21:25Z</updated>
		
		<summary type="html">&lt;p&gt;Admin: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;* navigation&lt;br /&gt;
** mainpage|mainpage&lt;br /&gt;
** Services|Services&lt;br /&gt;
** Protocols|Protocols&lt;br /&gt;
** Pricing|Pricing&lt;br /&gt;
** Personnel|Personnel&lt;br /&gt;
** Faq|Faq&lt;br /&gt;
** Calendar|Calendar&lt;br /&gt;
** Forms|Sample Submission&lt;br /&gt;
&lt;br /&gt;
* Resources&lt;br /&gt;
** Data_Analysis_Resources|Data Analysis&lt;br /&gt;
** Equipment_Resources|Equipment&lt;br /&gt;
** General_Links_Resources|General Links&lt;br /&gt;
** Ozone|Ozone Map&lt;/div&gt;</summary>
		<author><name>Admin</name></author>	</entry>

	</feed>